Bullet Biablo Bitcoin Dog - Mix of Golder Retriever, Husky, Labrador BK, Pug, Rottweiler, Maltese, Yorkshire Terrier and French Bulldog

Achievements

None
Bullet Biablo
Wassup? Yo, call me Bullet Biablo. I'll lick anything. Rolling around on the carpet after a bath is my favorite way to dry. I don't like it when my bowl is empty, so I take it to my human and it magically refills! I need someone that "brings home the bacon"!
  • Purity 8%
  • Age 9 months
  • Racing Exp 0
  • Golder Retriever 27%
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAACAAGAGCAGAACACACCAGATTAAGACGA
A
C
A
A
C
A
A
G
A
G
C
A
G
A
A
C
A
C
A
C
C
A
G
A
T
T
A
A
G
A
C
G
A
Genes: 44862HK8F89

Composition

Golder Retriever
27%
Husky
18%
Labrador BK
9%
Pug
9%
Rottweiler
9%
Maltese
9%
Yorkshire Terrier
9%
French Bulldog
9%

Current Energy

Vitality -15 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Husky
Legs Golder Retriever
Front Legs Labrador BK
Head Pug
Ears Rottweiler
Snout Maltese
Mouth Golder Retriever
Nose Yorkshire Terrier
Eyes Golder Retriever
Color French Bulldog