Bullet Biablo Bitcoin Dog - Mix of Golder Retriever, Husky, Labrador BK, Pug, Rottweiler, Maltese, Yorkshire Terrier and French Bulldog
Bullet Biablo
  • Purity 8%
  • Age 2 months
  • Racing Exp 0
  • Golder Retriever 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 0
Ecstatic & Fast

Achievements

None

Bio

Wassup? Yo, call me Bullet Biablo. I'll lick anything. Rolling around on the carpet after a bath is my favorite way to dry. I don't like it when my bowl is empty, so I take it to my human and it magically refills! I need someone that "brings home the bacon"!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACAACAAGAGCAGAACACACCAGATTAAGACGA
A
C
A
A
C
A
A
G
A
G
C
A
G
A
A
C
A
C
A
C
C
A
G
A
T
T
A
A
G
A
C
G
A
Genes: 44862HK8F89

Composition

Golder Retriever
27%
Husky
18%
Labrador BK
9%
Pug
9%
Rottweiler
9%
Maltese
9%
Yorkshire Terrier
9%
French Bulldog
9%

Current Energy

Vitality -4 points
Lunar Effect -8 points

Traits Breakdown

Body Husky
Tail Husky
Legs Golder Retriever
Front Legs Labrador BK
Head Pug
Ears Rottweiler
Snout Maltese
Mouth Golder Retriever
Nose Yorkshire Terrier
Eyes Golder Retriever
Color French Bulldog