Atta Austin Litecoin Dog - Mix of Pitbull terrier, Beagle, Husky, Maltese, Pug, Labrador, Corgi, Golder Retriever, Dachshund and French Bulldog
Atta Austin
  • Purity 1%
  • Age 36 months
  • Racing Exp 21
  • Pitbull terrier 18%
  • Gold medal 1 Silver medal 1 Bronze medal 0
  • 8 races
  • Gen 1
Sad & Snaillike

Achievements

Racer

Bio

Hello there, my name is Atta Austin. In my digital world, cats aren't the only ones who hack. I'm into chasing fast cars, squirrels and my tail. I hate going to the vet and will do almost anything to avoid it. I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk!

Racing Stats

Ran 8 races
  • 1 1 0
 Best Time16.88 sec
No rank  RacingĀ *** Pts
25.0% wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CTAACATCCACCGAACCAAGCAGAGGATCCCGA
C
T
A
A
C
A
T
C
C
A
C
C
G
A
A
C
C
A
A
G
C
A
G
A
G
G
A
T
C
C
C
G
A
Genes: D4NK25O8AN9

Composition

Pitbull terrier
18%
Beagle
9%
Husky
9%
Maltese
9%
Pug
9%
Labrador
9%
Corgi
9%
Golder Retriever
9%
Dachshund
9%
French Bulldog
9%

Current Energy

Vitality -65 points
Lunar Effect +8 points

Traits Breakdown

Body Beagle
Tail Husky
Legs Pitbull terrier
Front Legs Maltese
Head Pug
Ears Labrador
Snout Corgi
Mouth Golder Retriever
Nose Dachshund
Eyes Pitbull terrier
Color French Bulldog