Atta Austin Litecoin Dog - Mix of Pitbull terrier, Beagle, Husky, Maltese, Pug, Labrador, Corgi, Golder Retriever, Dachshund and French Bulldog

Achievements

Racer
Atta Austin
Hello there, my name is Atta Austin. In my digital world, cats aren't the only ones who hack. I'm into chasing fast cars, squirrels and my tail. I hate going to the vet and will do almost anything to avoid it. I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk!
  • Purity 1%
  • Age 7 months
  • Racing Exp 1
  • Pitbull terrier 18%
  • 1 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time18.95 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTAACATCCACCGAACCAAGCAGAGGATCCCGA
C
T
A
A
C
A
T
C
C
A
C
C
G
A
A
C
C
A
A
G
C
A
G
A
G
G
A
T
C
C
C
G
A
Genes: D4NK25O8AN9

Composition

Pitbull terrier
18%
Beagle
9%
Husky
9%
Maltese
9%
Pug
9%
Labrador
9%
Corgi
9%
Golder Retriever
9%
Dachshund
9%
French Bulldog
9%

Current Energy

Vitality -65 points
Lunar Effect +8 points

Traits Breakdown

Body Beagle
Tail Husky
Legs Pitbull terrier
Front Legs Maltese
Head Pug
Ears Labrador
Snout Corgi
Mouth Golder Retriever
Nose Dachshund
Eyes Pitbull terrier
Color French Bulldog