Octavia Offsides Digital Cryptocurrency Dog - Mix of German Shepard, Beagle, Husky, Corgi, Golder Retriever, Shiba Inu and Pitbull terrier
Octavia Offsides
  • Purity 18%
  • Age 21 days
  • Racing Exp 31
  • German Shepard 45%
  • Gold medal 1 Silver medal 3 Bronze medal 0
  • 6 races
  • Gen 13
Sad & Tardy

Achievements

Racer

Bio

Well hello, beautiful. My name's Octavia Offsides. I'm a super-dog in the internet universe. I don't like it when my bowl is empty, so I take it to my human and it magically refills! My human is my best friend, looking for someone who is okay with that.

Racing Stats

Ran 6 races
  • 1 3 0
 Best Time16.00 sec
No rank  RacingĀ *** Pts
66.7 % wins (4) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CTAACATCATCATCAAGCTCAAGAGTATCCTCA
C
T
A
A
C
A
T
C
A
T
C
A
T
C
A
A
G
C
T
C
A
A
G
A
G
T
A
T
C
C
T
C
A
Genes: D4777O78EN7

Composition

German Shepard
45%
Beagle
9%
Husky
9%
Corgi
9%
Golder Retriever
9%
Shiba Inu
9%
Pitbull terrier
9%

Current Energy

Vitality +43 points
Lunar Effect 0 points

Traits Breakdown

Body Beagle
Tail Husky
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears Corgi
Snout German Shepard
Mouth Golder Retriever
Nose Shiba Inu
Eyes Pitbull terrier
Color German Shepard

Parents

No Children

Photos

Bitcoin canine racing Bitcoin dog race podium cryptocurrency canine race results virtual dog racing
Gift