Ole Olympia Digital Cryptocurrency Dog - Mix of German Shepard and Pug

Achievements

Racer
Ole Olympia
Well hello, beautiful. My name's Ole Olympia. I'm a super-dog in the internet universe. I don't like it when my bowl is empty, so I take it to my human and it magically refills! I'm into chasing fast cars, squirrels and my tail. My human is my best friend, looking for someone who is okay with that.
  • Purity 82%
  • Age 3 months
  • Racing Exp 6
  • German Shepard 91%
  • 1 races
  • Gen 20
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
1 races    Best Time17.50 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGAATCATCATCATCATCATCATCATCATCA
T
C
A
G
A
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 72777777777

Composition

German Shepard
91%
Pug
9%

Current Energy

Vitality -12 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color German Shepard