Blueberry Boo Bitcoin Dog - Mix of German Shepard, Shiba Inu, Labrador, Corgi and Dachshund

Achievements

Racer
Blueberry Boo
I am on a mission to sniff all the butts in the world. ALL the butts. I wish my human wouldn't get mad at me for going through the trash. They were obviously finished with it, why can't I have it?! When my human brushes my coat, I get frisky! My favorite chews are underwear and rawhide...the rawhide lasts longer.
  • Purity 24%
  • Age 3 months
  • Racing Exp 34
  • German Shepard 45%
  • 8 races
  • Gen 12
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 3 0 1
 Best Time14.98 sec
No rank  Racing *** Pts
50.0 % wins (4) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAGTATCATCATCAAGCTCAGGAGTAGTATCA
C
C
A
G
T
A
T
C
A
T
C
A
T
C
A
A
G
C
T
C
A
G
G
A
G
T
A
G
T
A
T
C
A
Genes: 5E777O7AEE7

Composition

German Shepard
45%
Shiba Inu
27%
Labrador
9%
Corgi
9%
Dachshund
9%

Current Energy

Vitality +5 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Shiba Inu
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears Corgi
Snout German Shepard
Mouth Dachshund
Nose Shiba Inu
Eyes Shiba Inu
Color German Shepard