Baraka Beau Bitcoin Game Dog - Mix of German Shepard, Dachshund, Labrador, Corgi and Shiba Inu
Baraka Beau
  • Purity 24%
  • Age 36 months
  • Racing Exp 40
  • German Shepard 45%
  • Gold medal 2 Silver medal 2 Bronze medal 1
  • 9 races
  • Gen 18
Depressed & Snaillike

Achievements

Racer
Podium Champion
TOP 10 Fastest

Bio

Someday I'm gonna breakout from inside this server. I like it when you're frisky. I hate never catching that damn rabbit in my dreams. Sometimes I forget where I buried my bone. Rolling around on the carpet after a bath is my favorite way to dry.

Racing Stats

Ran 9 races
  • 2 2 1
 Best Time15.00 sec
Rank 2  RacingĀ *** Pts
55.6% wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCAGGATCATCATCAAGCTCAGGAGGAGTATCA
C
C
A
G
G
A
T
C
A
T
C
A
T
C
A
A
G
C
T
C
A
G
G
A
G
G
A
G
T
A
T
C
A
Genes: 5A777O7AAE7

Composition

German Shepard
45%
Dachshund
27%
Labrador
9%
Corgi
9%
Shiba Inu
9%

Current Energy

Vitality +5 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Dachshund
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears Corgi
Snout German Shepard
Mouth Dachshund
Nose Dachshund
Eyes Shiba Inu
Color German Shepard