Tracker Tabby Litecoin Dog - Mix of German Shepard and Dachshund

Achievements

Racer
Tracker Tabby
I love fetching anything my human throws! I need laid otherwise I'm going to start agreeing with Grumpy Cat. My favorite treat is to steal the pepperoni off of pizza. I hate going to the vet and will do almost anything to avoid it.
  • Purity 82%
  • Age 4 months
  • Racing Exp 9
  • German Shepard 91%
  • 2 races
  • Gen 19
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 0
2 races    Best Time16.07 sec
No rank  Racing *** Coins
50.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGGATCATCATCATCATCATCATCATCATCA
T
C
A
G
G
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 7A777777777

Composition

German Shepard
91%
Dachshund
9%

Current Energy

Vitality -12 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Dachshund
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color German Shepard