Tracker Tabby Litecoin Dog - Mix of German Shepard and Dachshund
Tracker Tabby
  • Purity 82%
  • Age 30 days
  • Racing Exp 40
  • German Shepard 91%
  • Gold medal 3 Silver medal 2 Bronze medal 0
  • 7 races
  • Gen 19
Neutral & Agile

Achievements

Racer

Bio

I love fetching anything my human throws! I need laid otherwise I'm going to start agreeing with Grumpy Cat. My favorite treat is to steal the pepperoni off of pizza. I hate going to the vet and will do almost anything to avoid it.

Racing Stats

Ran 7 races
  • 3 2 0
 Best Time14.77 sec
No rank  RacingĀ *** Pts
71.4 % wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCAGGATCATCATCATCATCATCATCATCATCA
T
C
A
G
G
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
Genes: 7A777777777

Composition

German Shepard
91%
Dachshund
9%

Current Energy

Vitality +48 points
Lunar Effect +4 points

Traits Breakdown

Body German Shepard
Tail Dachshund
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color German Shepard