Nyx Nana Crypto Game Dog - Mix of German Shepard, Husky and Dachshund

Achievements

Racer
Nyx Nana
Even living on the internet like I do, too much kibble makes my bandwidth expand. My turn-offs are rolled up newspapers and loud noises. My human's feet are definitely the greatest smell ever. Especially after a long day at work! I want a friend to poop with me in my neighbor's yard, just to watch him turn all shades of red.
  • Purity 51%
  • Age 43 days
  • Racing Exp 16
  • German Shepard 73%
  • 3 races
  • Gen 20
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 1 1 0
 Best Time15.88 sec
No rank  Racing *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAGGATCATCATCATCATCAACATCAACATCA
T
C
A
G
G
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
A
C
A
T
C
A
A
C
A
T
C
A
Genes: 7A777774747

Composition

German Shepard
73%
Husky
18%
Dachshund
9%

Current Energy

Vitality +52 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Dachshund
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth Husky
Nose German Shepard
Eyes Husky
Color German Shepard

Parents

No Children

Photos

crypto pet race crypto doggy race