Rocky Rags Crypto Game Dog - Mix of Pitbull terrier, Shiba Inu, Golder Retriever, Corgi, Dachshund, French Bulldog, Poodle and Labrador

Achievements

None
Rocky Rags
Even living on the internet like I do, too much kibble makes my bandwidth expand. My turn-offs are rolled up newspapers and loud noises. My human's feet are definitely the greatest smell ever. Especially after a long day at work! I want a friend to poop with me in my neighbor's yard, just to watch him turn all shades of red.
  • Purity 8%
  • Age 4 months
  • Racing Exp 0
  • Pitbull terrier 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCGTAAGATCCAGCGGACGAGTAGACCCATCC
T
C
C
G
T
A
A
G
A
T
C
C
A
G
C
G
G
A
C
G
A
G
T
A
G
A
C
C
C
A
T
C
C
Genes: NE8NOA9EI5N

Composition

Pitbull terrier
27%
Shiba Inu
18%
Golder Retriever
9%
Corgi
9%
Dachshund
9%
French Bulldog
9%
Poodle
9%
Labrador
9%

Current Energy

Vitality -28 points
Lunar Effect -4 points

Traits Breakdown

Body Pitbull terrier
Tail Shiba Inu
Legs Golder Retriever
Front Legs Pitbull terrier
Head Corgi
Ears Dachshund
Snout French Bulldog
Mouth Shiba Inu
Nose Poodle
Eyes Labrador
Color Pitbull terrier