Dane Diode Crypto Game Dog - Mix of Shiba Inu, French Bulldog, Pitbull terrier, St. Bernard, Labrador, Husky, Poodle, German Shepard, Corgi and Grey Wolf

Achievements

None
Dane Diode
I work in The Virtual Machine. I don't like running outta pee when there are still so many trees. Sometimes I just have to roll in something dead. If I had to pick a favorite food it would be a hot-dog, because you are what you eat! I just want a snuggle buddy with a nice, soft coat.
  • Purity 1%
  • Age 3 months
  • Racing Exp 0
  • Shiba Inu 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTACGATCCTGAGTACCAACAGACTCAAGCCCC
G
T
A
C
G
A
T
C
C
T
G
A
G
T
A
C
C
A
A
C
A
G
A
C
T
C
A
A
G
C
C
C
C
Genes: E9NBE54I7OL

Composition

Shiba Inu
18%
French Bulldog
9%
Pitbull terrier
9%
St. Bernard
9%
Labrador
9%
Husky
9%
Poodle
9%
German Shepard
9%
Corgi
9%
Grey Wolf
9%

Current Energy

Vitality -27 points
Lunar Effect -8 points

Traits Breakdown

Body Shiba Inu
Tail French Bulldog
Legs Pitbull terrier
Front Legs St. Bernard
Head Shiba Inu
Ears Labrador
Snout Husky
Mouth Poodle
Nose German Shepard
Eyes Corgi
Color Grey Wolf