Aires Adele Crypto Game Dog - Mix of German Shepard, Husky, Labrador, Corgi and Labrador BK
Aires Adele
  • Purity 23%
  • Age 21 days
  • Racing Exp 19
  • German Shepard 45%
  • Gold medal 2 Silver medal 0 Bronze medal 0
  • 5 races
  • Gen 18
Neutral & Agile

Achievements

Racer

Bio

I work in The Virtual Machine. I don't like running outta pee when there are still so many trees. Sometimes I just have to roll in something dead. If I had to pick a favorite food it would be a hot-dog, because you are what you eat! I just want a snuggle buddy with a nice, soft coat.

Racing Stats

Ran 5 races
  • 2 0 0
 Best Time15.87 sec
Rank 24  RacingĀ *** Pts
40.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCAACATCATCATCAAGCTCAACAGCAACATCA
C
C
A
A
C
A
T
C
A
T
C
A
T
C
A
A
G
C
T
C
A
A
C
A
G
C
A
A
C
A
T
C
A
Genes: 54777O74647

Composition

German Shepard
45%
Husky
27%
Labrador
9%
Corgi
9%
Labrador BK
9%

Current Energy

Vitality +65 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Husky
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears Corgi
Snout German Shepard
Mouth Husky
Nose Labrador BK
Eyes Husky
Color German Shepard