Travis Tony Litecoin Dog - Mix of Husky, Boxer, Corgi and Labrador BK
Travis Tony
  • Purity 37%
  • Age 51 days
  • Racing Exp 0
  • Husky 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 17
Sad & Snaillike

Achievements

None

Bio

My name is Travis Tony and I do tricks. Blue toilet water turns me off. The smell of fresh manure to roll in makes me wild. I'm an avid runner! Outside, inside, all over the place! I just want to run! I'm looking for someone to share my collection of artisan rawhide with!

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACAACAAACAACAACAGCACAACAGCAACAACA
A
C
A
A
C
A
A
A
C
A
A
C
A
A
C
A
G
C
A
C
A
A
C
A
G
C
A
A
C
A
A
C
A
Genes: 44GGGO44644

Composition

Husky
55%
Boxer
27%
Corgi
9%
Labrador BK
9%

Current Energy

Vitality +10 points
Lunar Effect +8 points

Traits Breakdown

Body Husky
Tail Husky
Legs Boxer
Front Legs Boxer
Head Boxer
Ears Corgi
Snout Husky
Mouth Husky
Nose Labrador BK
Eyes Husky
Color Husky