Travis Tony Litecoin Dog - Mix of Husky, Boxer, Corgi and Labrador BK

Achievements

Racer
Travis Tony
My name is Travis Tony and I do tricks. Blue toilet water turns me off. The smell of fresh manure to roll in makes me wild. I'm an avid runner! Outside, inside, all over the place! I just want to run! I'm looking for someone to share my collection of artisan rawhide with!
  • Purity 37%
  • Age 4 months
  • Racing Exp 16
  • Husky 55%
  • 5 races
  • Gen 17
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

5 races   |
  • 0 1 1
 Best Time16.13 sec
No rank  Racing *** Pts
40.0 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACAACAAACAACAACAGCACAACAGCAACAACA
A
C
A
A
C
A
A
A
C
A
A
C
A
A
C
A
G
C
A
C
A
A
C
A
G
C
A
A
C
A
A
C
A
Genes: 44GGGO44644

Composition

Husky
55%
Boxer
27%
Corgi
9%
Labrador BK
9%

Current Energy

Vitality -35 points
Lunar Effect +8 points

Traits Breakdown

Body Husky
Tail Husky
Legs Boxer
Front Legs Boxer
Head Boxer
Ears Corgi
Snout Husky
Mouth Husky
Nose Labrador BK
Eyes Husky
Color Husky