Dickens Deanna Cryptocurrency Dog - Mix of Husky and St. Bernard
Dickens Deanna
  • Purity 70%
  • Age 17 months
  • Racing Exp 16
  • Husky 82%
  • Gold medal 0 Silver medal 1 Bronze medal 1
  • 5 races
  • Gen 16
Sad & Tardy

Achievements

Racer

Bio

I'm Dickens Deanna. How goes it? If I had to pick a favorite food it would be a hot-dog, because you are what you eat! I'll outrun you for the ball if I can...that's just how I roll. I get really sad when I finish a bone, but my human has a magic power to just make new ones appear! Where are they coming from??

Racing Stats

Ran 5 races
  • 0 1 1
 Best Time15.80 sec
No rank  RacingĀ *** Pts
40.0 % wins (2) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACAACAACATGATGAACAACAACAACAACAACA
A
C
A
A
C
A
A
C
A
T
G
A
T
G
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
A
C
A
Genes: 444BB444444

Composition

Husky
82%
St. Bernard
18%

Current Energy

Vitality -14 points
Lunar Effect +26 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs St. Bernard
Head St. Bernard
Ears Husky
Snout Husky
Mouth Husky
Nose Husky
Eyes Husky
Color Husky