Aldo Abbott Crypto Dog - Mix of Husky, St. Bernard, Corgi, Schnauzer, Pug and Beagle

Achievements

Podium Champion
Pro Racer
Master Champion
Aldo Abbott
How do you do? I'm Aldo Abbott. I run with a pack in the data warehouse. I really dislike stinky flea collars. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day!
  • Purity 29%
  • Age 18 months
  • Racing Exp 117
  • Husky 55%
  • 30 races
  • Gen 10
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

30 races   |
  • 7 3 4
 Best Time14.65 sec
No rank  Racing *** Pts
46.7 % wins (14) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACAACAACATGAAGCATAACAACAACAGAACTA
A
C
A
A
C
A
A
C
A
T
G
A
A
G
C
A
T
A
A
C
A
A
C
A
A
C
A
G
A
A
C
T
A
Genes: 444BOC4442D

Composition

Husky
55%
St. Bernard
9%
Corgi
9%
Schnauzer
9%
Pug
9%
Beagle
9%

Current Energy

Vitality -30 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs St. Bernard
Head Corgi
Ears Schnauzer
Snout Husky
Mouth Husky
Nose Husky
Eyes Pug
Color Beagle