Aldo Abbott Crypto Dog - Mix of Husky, St. Bernard, Corgi, Schnauzer, Pug and Beagle
Aldo Abbott
  • Purity 29%
  • Age 15 months
  • Racing Exp 8
  • Husky 55%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 10
Depressed & Snaillike

Achievements

Racer

Bio

How do you do? I'm Aldo Abbott. I run with a pack in the data warehouse. I really dislike stinky flea collars. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I enjoy trying to be friends with the neighbor's cats. They still run away from me but they'll grow to love me one day!

Racing Stats

Ran 1 races
  • 1 0 0
 Best Time14.65 sec
No rank  RacingĀ *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACAACAACATGAAGCATAACAACAACAGAACTA
A
C
A
A
C
A
A
C
A
T
G
A
A
G
C
A
T
A
A
C
A
A
C
A
A
C
A
G
A
A
C
T
A
Genes: 444BOC4442D

Composition

Husky
55%
St. Bernard
9%
Corgi
9%
Schnauzer
9%
Pug
9%
Beagle
9%

Current Energy

Vitality -30 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Husky
Legs Husky
Front Legs St. Bernard
Head Corgi
Ears Schnauzer
Snout Husky
Mouth Husky
Nose Husky
Eyes Pug
Color Beagle