Mittens Molly Crypto Dog - Mix of Labrador, Husky, Corgi, Golder Retriever, Pug and Beagle

Achievements

Racer
Mittens Molly
Hello there, my name is Mittens Molly. I'm all about a hard drive because you can't do anything with a floppy disc. I wish my human wouldn't get mad at me for going through the trash. They were obviously finished with it, why can't I have it?! I 'm here for something RUFF ;)
  • Purity 15%
  • Age 20 months
  • Racing Exp 7
  • Labrador 36%
  • 2 races
  • Gen 11
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
2 races    Best Time15.92 sec
No rank  Racing *** Coins
50.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACACCAACACCAAGCAGACCACCAACAGAACTA
A
C
A
C
C
A
A
C
A
C
C
A
A
G
C
A
G
A
C
C
A
C
C
A
A
C
A
G
A
A
C
T
A
Genes: 4545O85542D

Composition

Labrador
36%
Husky
27%
Corgi
9%
Golder Retriever
9%
Pug
9%
Beagle
9%

Current Energy

Vitality -18 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Labrador
Legs Husky
Front Legs Labrador
Head Corgi
Ears Golder Retriever
Snout Labrador
Mouth Labrador
Nose Husky
Eyes Pug
Color Beagle