Mittens Molly Crypto Dog - Mix of Labrador, Husky, Corgi, Golder Retriever, Pug and Beagle
Mittens Molly
  • Purity 15%
  • Age 17 months
  • Racing Exp 27
  • Labrador 36%
  • Gold medal 2 Silver medal 0 Bronze medal 1
  • 8 races
  • Gen 11
Depressed & Snaillike

Achievements

Racer

Bio

Hello there, my name is Mittens Molly. I'm all about a hard drive because you can't do anything with a floppy disc. I wish my human wouldn't get mad at me for going through the trash. They were obviously finished with it, why can't I have it?! I 'm here for something RUFF ;)

Racing Stats

Ran 8 races
  • 2 0 1
 Best Time15.67 sec
No rank  RacingĀ *** Pts
37.5 % wins (3) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACACCAACACCAAGCAGACCACCAACAGAACTA
A
C
A
C
C
A
A
C
A
C
C
A
A
G
C
A
G
A
C
C
A
C
C
A
A
C
A
G
A
A
C
T
A
Genes: 4545O85542D

Composition

Labrador
36%
Husky
27%
Corgi
9%
Golder Retriever
9%
Pug
9%
Beagle
9%

Current Energy

Vitality -18 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Labrador
Legs Husky
Front Legs Labrador
Head Corgi
Ears Golder Retriever
Snout Labrador
Mouth Labrador
Nose Husky
Eyes Pug
Color Beagle