Pumba Pepe Virtual Crypto Game Dog - Mix of Labrador, Rottweiler, Poodle, Maltese, Boxer, Golder Retriever and Shiba Inu
Pumba Pepe
  • Purity 14%
  • Age 17 months
  • Racing Exp 37
  • Labrador 36%
  • Gold medal 2 Silver medal 0 Bronze medal 3
  • 8 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
Speed Champion

Bio

How do you do? I'm Pumba Pepe. Chasing that damn Nyan Cat out into some web traffic on the information superhighway in #1 on my bucket list. Air Bud is definitely my favorite movie. What a role model! I want to find someone I can wrestle with and nibble on. Does that sound like you?

Racing Stats

Ran 8 races
  • 2 0 3
 Best Time13.85 sec
Rank 62  RacingĀ *** Pts
62.5 % wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GACCCAACCCCAAACAGACCACCACACCACGTA
G
A
C
C
C
A
A
C
C
C
C
A
A
A
C
A
G
A
C
C
A
C
C
A
C
A
C
C
A
C
G
T
A
Genes: I5K5G855HHE

Composition

Labrador
36%
Rottweiler
18%
Poodle
9%
Maltese
9%
Boxer
9%
Golder Retriever
9%
Shiba Inu
9%

Current Energy

Vitality -48 points
Lunar Effect -8 points

Traits Breakdown

Body Poodle
Tail Labrador
Legs Maltese
Front Legs Labrador
Head Boxer
Ears Golder Retriever
Snout Labrador
Mouth Labrador
Nose Rottweiler
Eyes Rottweiler
Color Shiba Inu