Pumba Pepe Virtual Crypto Game Dog - Mix of Labrador, Rottweiler, Poodle, Maltese, Boxer, Golder Retriever and Shiba Inu
Pumba Pepe
  • Purity 14%
  • Age 13 months
  • Racing Exp 8
  • Labrador 36%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
Speed Champion
TOP 10 Fastest

Bio

How do you do? I'm Pumba Pepe. Chasing that damn Nyan Cat out into some web traffic on the information superhighway in #1 on my bucket list. Air Bud is definitely my favorite movie. What a role model! I want to find someone I can wrestle with and nibble on. Does that sound like you?

Racing Stats

Ran 1 races
  • 1 0 0
 Best Time13.85 sec
Rank 1  RacingĀ *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GACCCAACCCCAAACAGACCACCACACCACGTA
G
A
C
C
C
A
A
C
C
C
C
A
A
A
C
A
G
A
C
C
A
C
C
A
C
A
C
C
A
C
G
T
A
Genes: I5K5G855HHE

Composition

Labrador
36%
Rottweiler
18%
Poodle
9%
Maltese
9%
Boxer
9%
Golder Retriever
9%
Shiba Inu
9%

Current Energy

Vitality -48 points
Lunar Effect +4 points

Traits Breakdown

Body Poodle
Tail Labrador
Legs Maltese
Front Legs Labrador
Head Boxer
Ears Golder Retriever
Snout Labrador
Mouth Labrador
Nose Rottweiler
Eyes Rottweiler
Color Shiba Inu