Zoey Zena Bitcoin Dog - Mix of Labrador, Border Collie, Golder Retriever, Husky, Pug and Pitbull terrier
Zoey Zena
  • Purity 29%
  • Age 13 months
  • Racing Exp 8
  • Labrador 55%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 2 races
  • Gen 12
Depressed & Snaillike

Achievements

Racer

Bio

Hey there! Baby, call me Zoey Zena. I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. I hate having to share my food dish... I love a good book... I find them quite tasty. People food disagrees with me. Whew! You can tell.

Racing Stats

Ran 2 races
  • 0 1 0
 Best Time15.22 sec
Rank 70  RacingĀ *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCACCACCACCATACAGACCACCAACAGAATCC
C
C
A
C
C
A
C
C
A
C
C
A
T
A
C
A
G
A
C
C
A
C
C
A
A
C
A
G
A
A
T
C
C
Genes: 5555J85542N

Composition

Labrador
55%
Border Collie
9%
Golder Retriever
9%
Husky
9%
Pug
9%
Pitbull terrier
9%

Current Energy

Vitality +1 points
Lunar Effect -10 points

Traits Breakdown

Body Labrador
Tail Labrador
Legs Labrador
Front Legs Labrador
Head Border Collie
Ears Golder Retriever
Snout Labrador
Mouth Labrador
Nose Husky
Eyes Pug
Color Pitbull terrier