Zoey Zena Bitcoin Dog - Mix of Labrador, Border Collie, Golder Retriever, Husky, Pug and Pitbull terrier

Achievements

Podium Champion
Pro Racer
Zoey Zena
Hey there! Baby, call me Zoey Zena. I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. I hate having to share my food dish... I love a good book... I find them quite tasty. People food disagrees with me. Whew! You can tell.
  • Purity 29%
  • Age 18 months
  • Racing Exp 77
  • Labrador 55%
  • 22 races
  • Gen 12
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

22 races   |
  • 3 4 2
 Best Time15.17 sec
No rank  Racing *** Pts
40.9 % wins (9) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCACCACCACCATACAGACCACCAACAGAATCC
C
C
A
C
C
A
C
C
A
C
C
A
T
A
C
A
G
A
C
C
A
C
C
A
A
C
A
G
A
A
T
C
C
Genes: 5555J85542N

Composition

Labrador
55%
Border Collie
9%
Golder Retriever
9%
Husky
9%
Pug
9%
Pitbull terrier
9%

Current Energy

Vitality +1 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Labrador
Legs Labrador
Front Legs Labrador
Head Border Collie
Ears Golder Retriever
Snout Labrador
Mouth Labrador
Nose Husky
Eyes Pug
Color Pitbull terrier