Carter Chase Digital Cryptocurrency Dog - Mix of Labrador, Pitbull terrier, Poodle, Shiba Inu, French Bulldog and Border Collie
Carter Chase
  • Purity 12%
  • Age 13 months
  • Racing Exp 2
  • Labrador 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

My name is Carter Chase and I do tricks. Currently, I live on the information superhighway. Spiked dog collars really turn me on. I like it when you're frisky. I'm totally against baths! They are the worst! My favorite game is Fetch except I never bring the ball back.

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time17.00 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCATCCCCACGATACGACGACCCAGTAGTATCC
C
C
A
T
C
C
C
C
A
C
G
A
T
A
C
G
A
C
G
A
C
C
C
A
G
T
A
G
T
A
T
C
C
Genes: 5N59JII5EEN

Composition

Labrador
27%
Pitbull terrier
18%
Poodle
18%
Shiba Inu
18%
French Bulldog
9%
Border Collie
9%

Current Energy

Vitality -6 points
Lunar Effect -6 points

Traits Breakdown

Body Labrador
Tail Pitbull terrier
Legs Labrador
Front Legs French Bulldog
Head Border Collie
Ears Poodle
Snout Poodle
Mouth Labrador
Nose Shiba Inu
Eyes Shiba Inu
Color Pitbull terrier