Kissy Khloe Crypto Game Dog - Mix of Pug, Border Collie, Pitbull terrier, French Bulldog, Poodle, Labrador and Shiba Inu

Achievements

Racer
Kissy Khloe
Suh...you good? Kissy Khloe here. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! Small yappy creatures bug me...they disturb my zen. Eat, sleep, poop. Honey, I've got it made. I just want to "share a bone"... ;)
  • Purity 16%
  • Age 32 months
  • Racing Exp 31
  • Pug 36%
  • 8 races
  • Gen 2
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 0 3 1
 Best Time15.43 sec
Rank 50  Racing *** Coins
50.0 % wins (4) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAATCCGAACGATACTACGACCCAGTAGAAGAA
G
A
A
T
C
C
G
A
A
C
G
A
T
A
C
T
A
C
G
A
C
C
C
A
G
T
A
G
A
A
G
A
A
Genes: 2N29JJI5E22

Composition

Pug
36%
Border Collie
18%
Pitbull terrier
9%
French Bulldog
9%
Poodle
9%
Labrador
9%
Shiba Inu
9%

Current Energy

Vitality -55 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pitbull terrier
Legs Pug
Front Legs French Bulldog
Head Border Collie
Ears Border Collie
Snout Poodle
Mouth Labrador
Nose Shiba Inu
Eyes Pug
Color Pug