Kissy Khloe Crypto Game Dog - Mix of Pug, Border Collie, Pitbull terrier, French Bulldog, Poodle, Labrador and Shiba Inu
Kissy Khloe
  • Purity 16%
  • Age 13 months
  • Racing Exp 15
  • Pug 36%
  • Gold medal 0 Silver medal 2 Bronze medal 0
  • 3 races
  • Gen 2
Depressed & Snaillike

Achievements

Racer

Bio

Suh...you good? Kissy Khloe here. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! Small yappy creatures bug me...they disturb my zen. Eat, sleep, poop. Honey, I've got it made. I just want to "share a bone"... ;)

Racing Stats

Ran 3 races
  • 0 2 0
 Best Time15.80 sec
Rank 96  RacingĀ *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAATCCGAACGATACTACGACCCAGTAGAAGAA
G
A
A
T
C
C
G
A
A
C
G
A
T
A
C
T
A
C
G
A
C
C
C
A
G
T
A
G
A
A
G
A
A
Genes: 2N29JJI5E22

Composition

Pug
36%
Border Collie
18%
Pitbull terrier
9%
French Bulldog
9%
Poodle
9%
Labrador
9%
Shiba Inu
9%

Current Energy

Vitality -55 points
Lunar Effect -2 points

Traits Breakdown

Body Pug
Tail Pitbull terrier
Legs Pug
Front Legs French Bulldog
Head Border Collie
Ears Border Collie
Snout Poodle
Mouth Labrador
Nose Shiba Inu
Eyes Pug
Color Pug

Parents

No Children

Photos

cryptocurrency pet race Litecoin pet race
Gift