Ackbar Angus Cryptocurrency Dog - Mix of Pug, Shiba Inu, Golder Retriever, Boxer, Border Collie, Yorkshire Terrier, Pitbull terrier and Maltese

Achievements

Racer
Ackbar Angus
Hey, good-looking! This is Ackbar Angus. The internet's my home. I love barking all night when others try to sleep. I don't understand why my human tries to give me tap water. I expect filtered and distilled! Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays.
  • Purity 12%
  • Age 38 months
  • Racing Exp 57
  • Pug 36%
  • 20 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

20 races   |
  • 0 2 5
 Best Time14.53 sec
No rank  Racing *** Pts
35.0 % wins (7) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GAAGTAGAAAGAAACTACTTATCCACCGAAGAA
G
A
A
G
T
A
G
A
A
A
G
A
A
A
C
T
A
C
T
T
A
T
C
C
A
C
C
G
A
A
G
A
A
Genes: 2E28GJFNK22

Composition

Pug
36%
Shiba Inu
9%
Golder Retriever
9%
Boxer
9%
Border Collie
9%
Yorkshire Terrier
9%
Pitbull terrier
9%
Maltese
9%

Current Energy

Vitality -62 points
Lunar Effect +4 points

Traits Breakdown

Body Pug
Tail Shiba Inu
Legs Pug
Front Legs Golder Retriever
Head Boxer
Ears Border Collie
Snout Yorkshire Terrier
Mouth Pitbull terrier
Nose Maltese
Eyes Pug
Color Pug