Laika Lincoln Crypto Dog - Mix of Pug, Rottweiler, Poodle, Corgi, Border Collie and Dachshund

Achievements

Racer
TOP 10 Fastest
Laika Lincoln
I never knew my father. I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. I'm ready to settle down and have puppies...what about you?
  • Purity 20%
  • Age 42 months
  • Racing Exp 70
  • Pug 45%
  • 26 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

26 races   |
  • 0 4 4
 Best Time14.67 sec
Rank 7  Racing *** Coins
30.8 % wins (8) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACGAAGAAGACAGCTACGAACACGGAGAAGAA
C
A
C
G
A
A
G
A
A
G
A
C
A
G
C
T
A
C
G
A
A
C
A
C
G
G
A
G
A
A
G
A
A
Genes: H22IOJ2HA22

Composition

Pug
45%
Rottweiler
18%
Poodle
9%
Corgi
9%
Border Collie
9%
Dachshund
9%

Current Energy

Vitality -55 points
Lunar Effect -4 points

Traits Breakdown

Body Rottweiler
Tail Pug
Legs Pug
Front Legs Poodle
Head Corgi
Ears Border Collie
Snout Pug
Mouth Rottweiler
Nose Dachshund
Eyes Pug
Color Pug