Laika Lincoln Crypto Dog - Mix of Pug, Rottweiler, Poodle, Corgi, Border Collie and Dachshund
Laika Lincoln
  • Purity 20%
  • Age 35 months
  • Racing Exp 60
  • Pug 45%
  • Gold medal 0 Silver medal 4 Bronze medal 3
  • 21 races
  • Gen 0
Depressed & Snaillike

Achievements

Pro Racer

Bio

I never knew my father. I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. I'm ready to settle down and have puppies...what about you?

Racing Stats

Ran 21 races
  • 0 4 3
 Best Time14.67 sec
No rank  RacingĀ *** Pts
33.3 % wins (7) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACGAAGAAGACAGCTACGAACACGGAGAAGAA
C
A
C
G
A
A
G
A
A
G
A
C
A
G
C
T
A
C
G
A
A
C
A
C
G
G
A
G
A
A
G
A
A
Genes: H22IOJ2HA22

Composition

Pug
45%
Rottweiler
18%
Poodle
9%
Corgi
9%
Border Collie
9%
Dachshund
9%

Current Energy

Vitality -55 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Pug
Legs Pug
Front Legs Poodle
Head Corgi
Ears Border Collie
Snout Pug
Mouth Rottweiler
Nose Dachshund
Eyes Pug
Color Pug