Alice Adam Crypto Dog - Mix of Pug, Husky, Poodle, St. Bernard, Border Collie and Beagle

Achievements

Racer
Podium Champion
Master Champion
Alice Adam
Hey! Call me Alice Adam. I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. I hate it when my humans fool me with a pill in peanut butter! I'm looking for someone smart enough to help me find the treat stash.
  • Purity 27%
  • Age 18 months
  • Racing Exp 86
  • Pug 55%
  • 30 races
  • Gen 14
Share it to make him Happy!
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

30 races   |
  • 2 2 6
 Best Time15.42 sec
No rank  Racing *** Pts
33.3 % wins (10) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACAGAAGAAGACTGATACGAAGAACTAGAAGAA
A
C
A
G
A
A
G
A
A
G
A
C
T
G
A
T
A
C
G
A
A
G
A
A
C
T
A
G
A
A
G
A
A
Genes: 422IBJ22D22

Composition

Pug
55%
Husky
9%
Poodle
9%
St. Bernard
9%
Border Collie
9%
Beagle
9%

Current Energy

Vitality -45 points
Lunar Effect +4 points

Traits Breakdown

Body Husky
Tail Pug
Legs Pug
Front Legs Poodle
Head St. Bernard
Ears Border Collie
Snout Pug
Mouth Pug
Nose Beagle
Eyes Pug
Color Pug