Alice Adam Crypto Dog - Mix of Pug, Husky, Poodle, St. Bernard, Border Collie and Beagle
Alice Adam
  • Purity 27%
  • Age 13 months
  • Racing Exp 14
  • Pug 55%
  • Gold medal 0 Silver medal 0 Bronze medal 2
  • 4 races
  • Gen 14
Depressed & Snaillike

Achievements

Racer

Bio

Hey! Call me Alice Adam. I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. I hate it when my humans fool me with a pill in peanut butter! I'm looking for someone smart enough to help me find the treat stash.

Racing Stats

Ran 4 races
  • 0 0 2
 Best Time16.60 sec
No rank  RacingĀ *** Pts
50.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACAGAAGAAGACTGATACGAAGAACTAGAAGAA
A
C
A
G
A
A
G
A
A
G
A
C
T
G
A
T
A
C
G
A
A
G
A
A
C
T
A
G
A
A
G
A
A
Genes: 422IBJ22D22

Composition

Pug
55%
Husky
9%
Poodle
9%
St. Bernard
9%
Border Collie
9%
Beagle
9%

Current Energy

Vitality -45 points
Lunar Effect +4 points

Traits Breakdown

Body Husky
Tail Pug
Legs Pug
Front Legs Poodle
Head St. Bernard
Ears Border Collie
Snout Pug
Mouth Pug
Nose Beagle
Eyes Pug
Color Pug