Perla Prince of Barkness Crypto Game Dog - Mix of Pug, Husky, Beagle, Rottweiler, St. Bernard and Border Collie

Achievements

Racer
Perla Prince of Barkness
Suh...you good? Perla Prince of Barkness here. Once you go digital, baby, you never go back. I hate it when my humans fool me with a pill in peanut butter! In my humble opinion the best toy is one of my human's stinky, old socks. If we can run as a pack for a while, I'm open to that.
  • Purity 15%
  • Age 21 months
  • Racing Exp 2
  • Pug 36%
  • 2 races
  • Gen 13
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
2 races    Best Time17.12 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAGAAGAACACTGATACCTAGAACTAGAAACA
A
C
A
G
A
A
G
A
A
C
A
C
T
G
A
T
A
C
C
T
A
G
A
A
C
T
A
G
A
A
A
C
A
Genes: 422HBJD2D24

Composition

Pug
36%
Husky
18%
Beagle
18%
Rottweiler
9%
St. Bernard
9%
Border Collie
9%

Current Energy

Vitality -40 points
Lunar Effect +4 points

Traits Breakdown

Body Husky
Tail Pug
Legs Pug
Front Legs Rottweiler
Head St. Bernard
Ears Border Collie
Snout Beagle
Mouth Pug
Nose Beagle
Eyes Pug
Color Husky