Perla Prince of Barkness Crypto Game Dog - Mix of Pug, Husky, Beagle, Rottweiler, St. Bernard and Border Collie
Perla Prince of Barkness
  • Purity 15%
  • Age 16 months
  • Racing Exp 2
  • Pug 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 13
Depressed & Snaillike

Achievements

Racer

Bio

Suh...you good? Perla Prince of Barkness here. Once you go digital, baby, you never go back. I hate it when my humans fool me with a pill in peanut butter! In my humble opinion the best toy is one of my human's stinky, old socks. If we can run as a pack for a while, I'm open to that.

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time17.12 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACAGAAGAACACTGATACCTAGAACTAGAAACA
A
C
A
G
A
A
G
A
A
C
A
C
T
G
A
T
A
C
C
T
A
G
A
A
C
T
A
G
A
A
A
C
A
Genes: 422HBJD2D24

Composition

Pug
36%
Husky
18%
Beagle
18%
Rottweiler
9%
St. Bernard
9%
Border Collie
9%

Current Energy

Vitality -40 points
Lunar Effect -10 points

Traits Breakdown

Body Husky
Tail Pug
Legs Pug
Front Legs Rottweiler
Head St. Bernard
Ears Border Collie
Snout Beagle
Mouth Pug
Nose Beagle
Eyes Pug
Color Husky