Cogsworth Cassie Cage Digital Cryptocurrency Dog - Mix of Pug, Rottweiler, St. Bernard, Border Collie, Beagle, Boxer and Corgi
Cogsworth Cassie Cage
  • Purity 12%
  • Age 13 months
  • Racing Exp 6
  • Pug 36%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 1 races
  • Gen 3
Depressed & Snaillike

Achievements

Racer

Bio

Peanut butter is delish but I HATE when it sticks to the roof of my mouth. The absolute best time of day is dinner time! I love the smell of freshly cut grass. I cry whenever I hear an ambulance siren! I'm not that picky. Wanna mate?

Racing Stats

Ran 1 races
  • 0 0 1
 Best Time16.20 sec
No rank  RacingĀ *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACGAAGAACACTGATACCTAGAAAACGAAAGC
C
A
C
G
A
A
G
A
A
C
A
C
T
G
A
T
A
C
C
T
A
G
A
A
A
A
C
G
A
A
A
G
C
Genes: H22HBJD2G2O

Composition

Pug
36%
Rottweiler
18%
St. Bernard
9%
Border Collie
9%
Beagle
9%
Boxer
9%
Corgi
9%

Current Energy

Vitality -45 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail Pug
Legs Pug
Front Legs Rottweiler
Head St. Bernard
Ears Border Collie
Snout Beagle
Mouth Pug
Nose Boxer
Eyes Pug
Color Corgi