Cogsworth Cassie Cage Digital Cryptocurrency Dog - Mix of Pug, Rottweiler, St. Bernard, Border Collie, Beagle, Boxer and Corgi

Achievements

Racer
Cogsworth Cassie Cage
Peanut butter is delish but I HATE when it sticks to the roof of my mouth. The absolute best time of day is dinner time! I love the smell of freshly cut grass. I cry whenever I hear an ambulance siren! I'm not that picky. Wanna mate?
  • Purity 12%
  • Age 20 months
  • Racing Exp 11
  • Pug 36%
  • 6 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
6 races    Best Time15.40 sec
No rank  Racing *** Coins
16.7 % wins (1) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: CACGAAGAACACTGATACCTAGAAAACGAAAGC
C
A
C
G
A
A
G
A
A
C
A
C
T
G
A
T
A
C
C
T
A
G
A
A
A
A
C
G
A
A
A
G
C
Genes: H22HBJD2G2O

Composition

Pug
36%
Rottweiler
18%
St. Bernard
9%
Border Collie
9%
Beagle
9%
Boxer
9%
Corgi
9%

Current Energy

Vitality -45 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail Pug
Legs Pug
Front Legs Rottweiler
Head St. Bernard
Ears Border Collie
Snout Beagle
Mouth Pug
Nose Boxer
Eyes Pug
Color Corgi