Gordo Google Litecoin Game Dog - Mix of Rottweiler, St. Bernard, Labrador, Schnauzer, Beagle, German Shepard, Boxer, Maltese and Corgi

Achievements

Racer
Podium Champion
Gordo Google
Gordo Google here. Wanna play? I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. Sometimes I forget where I buried my bone.
  • Purity 3%
  • Age 18 months
  • Racing Exp 72
  • Rottweiler 18%
  • 24 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

24 races   |
  • 3 2 3
 Best Time15.82 sec
No rank  Racing *** Pts
33.3 % wins (8) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACCCATGACACTGAATACTATCAAACACCAGC
C
A
C
C
C
A
T
G
A
C
A
C
T
G
A
A
T
A
C
T
A
T
C
A
A
A
C
A
C
C
A
G
C
Genes: H5BHBCD7GKO

Composition

Rottweiler
18%
St. Bernard
18%
Labrador
9%
Schnauzer
9%
Beagle
9%
German Shepard
9%
Boxer
9%
Maltese
9%
Corgi
9%

Current Energy

Vitality -35 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Labrador
Legs St. Bernard
Front Legs Rottweiler
Head St. Bernard
Ears Schnauzer
Snout Beagle
Mouth German Shepard
Nose Boxer
Eyes Maltese
Color Corgi