Gordo Google Litecoin Game Dog - Mix of Rottweiler, St. Bernard, Labrador, Schnauzer, Beagle, German Shepard, Boxer, Maltese and Corgi
Gordo Google
  • Purity 3%
  • Age 13 months
  • Racing Exp 6
  • Rottweiler 18%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Gordo Google here. Wanna play? I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. Sometimes I forget where I buried my bone.

Racing Stats

Ran 1 races
  • 0 0 1
 Best Time16.27 sec
No rank  RacingĀ *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACCCATGACACTGAATACTATCAAACACCAGC
C
A
C
C
C
A
T
G
A
C
A
C
T
G
A
A
T
A
C
T
A
T
C
A
A
A
C
A
C
C
A
G
C
Genes: H5BHBCD7GKO

Composition

Rottweiler
18%
St. Bernard
18%
Labrador
9%
Schnauzer
9%
Beagle
9%
German Shepard
9%
Boxer
9%
Maltese
9%
Corgi
9%

Current Energy

Vitality -35 points
Lunar Effect +2 points

Traits Breakdown

Body Rottweiler
Tail Labrador
Legs St. Bernard
Front Legs Rottweiler
Head St. Bernard
Ears Schnauzer
Snout Beagle
Mouth German Shepard
Nose Boxer
Eyes Maltese
Color Corgi