Snuggles Smoke Crypto Game Dog - Mix of Pug, Border Collie, Rottweiler and Labrador BK
Snuggles Smoke
  • Purity 41%
  • Age 52 months
  • Racing Exp 171
  • Pug 64%
  • Gold medal 9 Silver medal 4 Bronze medal 9
  • 39 races
  • Gen 2
Depressed & Snaillike

Achievements

Podium Champion
Pro Racer
Master Champion

Bio

Hey! Call me Snuggles Smoke. I live in your digital dreams. Air Bud is definitely my favorite movie. What a role model! I'm not into dog collars, unless you're into S & M. I'm willing to try little bondage, so my human chained me up! I enjoy finding and eating frozen cat turds in the winter. Bon appétit!

Racing Stats

Ran 39 races
  • 9 4 9
 Best Time14.75 sec
Rank 84  Racing *** Pts
56.4% wins (22) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: CACGAAGAATACGCATACGAAGAAGAAGAAGAA
C
A
C
G
A
A
G
A
A
T
A
C
G
C
A
T
A
C
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
Genes: H22J6J22222

Composition

Pug
64%
Border Collie
18%
Rottweiler
9%
Labrador BK
9%

Current Energy

Vitality -43 points
Lunar Effect -12 points

Traits Breakdown

Body Rottweiler
Tail Pug
Legs Pug
Front Legs Border Collie
Head Labrador BK
Ears Border Collie
Snout Pug
Mouth Pug
Nose Pug
Eyes Pug
Color Pug