K-9 Kitana Litecoin Dog - Mix of Pug, Rottweiler, Labrador, Labrador BK, Shiba Inu, Poodle and St. Bernard

Achievements

Racer
K-9 Kitana
Hi! My name is K-9 Kitana. I hate going to the vet and will do almost anything to avoid it. My female human wears crotchless undies, but she doesn't like the ones I make for her! I like to respond to sad puppy eyes with sad puppy eyes of my own. Getting out of a long relationship, not looking for another
  • Purity 20%
  • Age 21 months
  • Racing Exp 8
  • Pug 45%
  • 3 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
3 races    Best Time14.60 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACGAAGAACCAGCAGTAGAAGAAGAAGACTGA
C
A
C
G
A
A
G
A
A
C
C
A
G
C
A
G
T
A
G
A
A
G
A
A
G
A
A
G
A
C
T
G
A
Genes: H2256E222IB

Composition

Pug
45%
Rottweiler
9%
Labrador
9%
Labrador BK
9%
Shiba Inu
9%
Poodle
9%
St. Bernard
9%

Current Energy

Vitality -38 points
Lunar Effect -12 points

Traits Breakdown

Body Rottweiler
Tail Pug
Legs Pug
Front Legs Labrador
Head Labrador BK
Ears Shiba Inu
Snout Pug
Mouth Pug
Nose Pug
Eyes Poodle
Color St. Bernard