K-9 Kitana Litecoin Dog - Mix of Pug, Rottweiler, Labrador, Labrador BK, Shiba Inu, Poodle and St. Bernard
K-9 Kitana
  • Purity 20%
  • Age 13 months
  • Racing Exp 8
  • Pug 45%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 3 races
  • Gen 3
Depressed & Snaillike

Achievements

Racer
TOP 10 Fastest

Bio

Hi! My name is K-9 Kitana. I hate going to the vet and will do almost anything to avoid it. My female human wears crotchless undies, but she doesn't like the ones I make for her! I like to respond to sad puppy eyes with sad puppy eyes of my own. Getting out of a long relationship, not looking for another

Racing Stats

Ran 3 races
  • 0 0 1
 Best Time14.60 sec
Rank 6  RacingĀ *** Pts
33.3 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACGAAGAACCAGCAGTAGAAGAAGAAGACTGA
C
A
C
G
A
A
G
A
A
C
C
A
G
C
A
G
T
A
G
A
A
G
A
A
G
A
A
G
A
C
T
G
A
Genes: H2256E222IB

Composition

Pug
45%
Rottweiler
9%
Labrador
9%
Labrador BK
9%
Shiba Inu
9%
Poodle
9%
St. Bernard
9%

Current Energy

Vitality -38 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Pug
Legs Pug
Front Legs Labrador
Head Labrador BK
Ears Shiba Inu
Snout Pug
Mouth Pug
Nose Pug
Eyes Poodle
Color St. Bernard

Parents

No Children

Photos

crypto canine race podium
Gift