K-9 Kitana Litecoin Dog - Mix of Pug, Rottweiler, Labrador, Labrador BK, Shiba Inu, Poodle and St. Bernard
K-9 Kitana
  • Purity 20%
  • Age 52 months
  • Racing Exp 35
  • Pug 45%
  • Gold medal 1 Silver medal 2 Bronze medal 1
  • 11 races
  • Gen 3
Depressed & Snaillike

Achievements

Racer
Podium Champion

Bio

Hi! My name is K-9 Kitana. I hate going to the vet and will do almost anything to avoid it. My female human wears crotchless undies, but she doesn't like the ones I make for her! I like to respond to sad puppy eyes with sad puppy eyes of my own. Getting out of a long relationship, not looking for another

Racing Stats

Ran 11 races
  • 1 2 1
 Best Time14.60 sec
Rank 97  RacingĀ *** Pts
36.4% wins (4) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACGAAGAACCAGCAGTAGAAGAAGAAGACTGA
C
A
C
G
A
A
G
A
A
C
C
A
G
C
A
G
T
A
G
A
A
G
A
A
G
A
A
G
A
C
T
G
A
Genes: H2256E222IB

Composition

Pug
45%
Rottweiler
9%
Labrador
9%
Labrador BK
9%
Shiba Inu
9%
Poodle
9%
St. Bernard
9%

Current Energy

Vitality -38 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Pug
Legs Pug
Front Legs Labrador
Head Labrador BK
Ears Shiba Inu
Snout Pug
Mouth Pug
Nose Pug
Eyes Poodle
Color St. Bernard