Sage Sticks Cryptocurrency Dog - Mix of Pug, Labrador, Rottweiler, German Shepard, Husky and St. Bernard
Sage Sticks
  • Purity 21%
  • Age 35 months
  • Racing Exp 62
  • Pug 45%
  • Gold medal 5 Silver medal 2 Bronze medal 1
  • 10 races
  • Gen 4
Sad & Snaillike

Achievements

Podium Champion
Pro Racer

Bio

I'd like to take you for a byte to eat in cyberspace. I'm willing to try little bondage, so my human chained me up! I'll be honest...Napping is my favorite so we gotta go slow. I love waking up early then indulging in long afternoon naps. I hate it when humans put the lid down.

Racing Stats

Ran 10 races
  • 5 2 1
 Best Time15.07 sec
Rank 78  RacingĀ *** Pts
80.0% wins (8) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACGAAGAACCATCACCAGAAGAAGAAACATGA
C
A
C
G
A
A
G
A
A
C
C
A
T
C
A
C
C
A
G
A
A
G
A
A
G
A
A
A
C
A
T
G
A
Genes: H225752224B

Composition

Pug
45%
Labrador
18%
Rottweiler
9%
German Shepard
9%
Husky
9%
St. Bernard
9%

Current Energy

Vitality -26 points
Lunar Effect +8 points

Traits Breakdown

Body Rottweiler
Tail Pug
Legs Pug
Front Legs Labrador
Head German Shepard
Ears Labrador
Snout Pug
Mouth Pug
Nose Pug
Eyes Husky
Color St. Bernard

Parents

No Children

Photos

online dog race Bitcoin dog racing Litecoin dog racing online doggy racing results cryptocurrency pet race photo Litecoin doggy racing podium cryptocurrency pet racing results Litecoin canine racing results
Gift