Dickens Dynamite Cryptocurrency Dog - Mix of Corgi, Yorkshire Terrier, St. Bernard, Poodle, Shiba Inu, Boxer and Pitbull terrier

Achievements

Racer
Dickens Dynamite
I'd like to take you for a byte to eat in cyberspace. I'm willing to try little bondage, so my human chained me up! I'll be honest...Napping is my favorite so we gotta go slow. I love waking up early then indulging in long afternoon naps. I hate it when humans put the lid down.
  • Purity 12%
  • Age 3 months
  • Racing Exp 8
  • Corgi 27%
  • 1 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 0
1 races    Best Time16.35 sec
No rank  Racing *** Coins
100.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCAGCTGAGACTTAGTATTAAACTTATCCAGC
A
G
C
A
G
C
T
G
A
G
A
C
T
T
A
G
T
A
T
T
A
A
A
C
T
T
A
T
C
C
A
G
C
Genes: OOBIFEFGFNO

Composition

Corgi
27%
Yorkshire Terrier
27%
St. Bernard
9%
Poodle
9%
Shiba Inu
9%
Boxer
9%
Pitbull terrier
9%

Current Energy

Vitality -30 points
Lunar Effect 0 points

Traits Breakdown

Body Corgi
Tail Corgi
Legs St. Bernard
Front Legs Poodle
Head Yorkshire Terrier
Ears Shiba Inu
Snout Yorkshire Terrier
Mouth Boxer
Nose Yorkshire Terrier
Eyes Pitbull terrier
Color Corgi