Oreo Oakley Bitcoin Dog - Mix of German Shepard, Corgi, Labrador BK, St. Bernard, Grey Wolf, Labrador, Pug, Husky and Beagle
Oreo Oakley
  • Purity 7%
  • Age 15 months
  • Racing Exp 22
  • German Shepard 18%
  • Gold medal 2 Silver medal 0 Bronze medal 1
  • 3 races
  • Gen 0
Sad & Slothful

Achievements

Racer

Bio

Hey there... I'm Oreo Oakley. As a digital dog, let me say Bob Dole did not invent the internet. I'd like to help you shed your coat, baby. Sometimes I forget where I buried my bone. If I had to pick a favorite food it would be a hot-dog, because you are what you eat!

Racing Stats

Ran 3 races
  • 2 0 1
 Best Time16.35 sec
No rank  RacingĀ *** Pts
100.0 % wins (3) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GCATGACCCTCATCACCAGAAAGCAGCACACTA
G
C
A
T
G
A
C
C
C
T
C
A
T
C
A
C
C
A
G
A
A
A
G
C
A
G
C
A
C
A
C
T
A
Genes: 6BL7752OO4D

Composition

German Shepard
18%
Corgi
18%
Labrador BK
9%
St. Bernard
9%
Grey Wolf
9%
Labrador
9%
Pug
9%
Husky
9%
Beagle
9%

Current Energy

Vitality +7 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail St. Bernard
Legs Grey Wolf
Front Legs German Shepard
Head German Shepard
Ears Labrador
Snout Pug
Mouth Corgi
Nose Corgi
Eyes Husky
Color Beagle