Oreo Oakley Bitcoin Dog - Mix of German Shepard, Corgi, Labrador BK, St. Bernard, Grey Wolf, Labrador, Pug, Husky and Beagle

Achievements

Racer
Podium Champion
Oreo Oakley
Hey there... I'm Oreo Oakley. As a digital dog, let me say Bob Dole did not invent the internet. I'd like to help you shed your coat, baby. Sometimes I forget where I buried my bone. If I had to pick a favorite food it would be a hot-dog, because you are what you eat!
  • Purity 7%
  • Age 18 months
  • Racing Exp 61
  • German Shepard 18%
  • 9 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

9 races   |
  • 5 2 1
 Best Time15.40 sec
No rank  Racing *** Pts
88.9 % wins (8) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCATGACCCTCATCACCAGAAAGCAGCACACTA
G
C
A
T
G
A
C
C
C
T
C
A
T
C
A
C
C
A
G
A
A
A
G
C
A
G
C
A
C
A
C
T
A
Genes: 6BL7752OO4D

Composition

German Shepard
18%
Corgi
18%
Labrador BK
9%
St. Bernard
9%
Grey Wolf
9%
Labrador
9%
Pug
9%
Husky
9%
Beagle
9%

Current Energy

Vitality +7 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail St. Bernard
Legs Grey Wolf
Front Legs German Shepard
Head German Shepard
Ears Labrador
Snout Pug
Mouth Corgi
Nose Corgi
Eyes Husky
Color Beagle