Teddybear Tiggy Cryptocurrency Dog - Mix of Shiba Inu, German Shepard, Labrador, Labrador BK, St. Bernard and Corgi

Achievements

Racer
Teddybear Tiggy
Have you ever dated a digital creation before? I'm the best at running circle 8's. I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! Spiked dog collars really turn me on. I believe running along the beach to catch a stick can be nearly orgasmic.
  • Purity 17%
  • Age 21 months
  • Racing Exp 25
  • Shiba Inu 36%
  • 4 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 3 0 0
4 races    Best Time14.42 sec
No rank  Racing *** Coins
75.0 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCATGAGTATCATCAGTAGTAAGCCCACCAGTA
G
C
A
T
G
A
G
T
A
T
C
A
T
C
A
G
T
A
G
T
A
A
G
C
C
C
A
C
C
A
G
T
A
Genes: 6BE77EEO55E

Composition

Shiba Inu
36%
German Shepard
18%
Labrador
18%
Labrador BK
9%
St. Bernard
9%
Corgi
9%

Current Energy

Vitality -8 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador BK
Tail St. Bernard
Legs Shiba Inu
Front Legs German Shepard
Head German Shepard
Ears Shiba Inu
Snout Shiba Inu
Mouth Corgi
Nose Labrador
Eyes Labrador
Color Shiba Inu