Teddybear Tiggy Cryptocurrency Dog - Mix of Shiba Inu, German Shepard, Labrador, Labrador BK, St. Bernard and Corgi
Teddybear Tiggy
  • Purity 17%
  • Age 16 months
  • Racing Exp 24
  • Shiba Inu 36%
  • Gold medal 3 Silver medal 0 Bronze medal 0
  • 3 races
  • Gen 2
Depressed & Snaillike

Achievements

Racer
TOP 10 Fastest

Bio

Have you ever dated a digital creation before? I'm the best at running circle 8's. I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! Spiked dog collars really turn me on. I believe running along the beach to catch a stick can be nearly orgasmic.

Racing Stats

Ran 3 races
  • 3 0 0
 Best Time14.42 sec
Rank 3  RacingĀ *** Pts
100.0 % wins (3) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GCATGAGTATCATCAGTAGTAAGCCCACCAGTA
G
C
A
T
G
A
G
T
A
T
C
A
T
C
A
G
T
A
G
T
A
A
G
C
C
C
A
C
C
A
G
T
A
Genes: 6BE77EEO55E

Composition

Shiba Inu
36%
German Shepard
18%
Labrador
18%
Labrador BK
9%
St. Bernard
9%
Corgi
9%

Current Energy

Vitality -8 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail St. Bernard
Legs Shiba Inu
Front Legs German Shepard
Head German Shepard
Ears Shiba Inu
Snout Shiba Inu
Mouth Corgi
Nose Labrador
Eyes Labrador
Color Shiba Inu