Carrera Chandler Litecoin Dog - Mix of Shiba Inu, Labrador, Grey Wolf and Schnauzer

Achievements

None
Carrera Chandler
Ima Ethernet dog. I've been known to run with bad dogs. You may prefer walking, but hey, if a human wants to carry me, I'll let 'em. I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good...
  • Purity 35%
  • Age 26 months
  • Racing Exp 0
  • Shiba Inu 55%
  • 0 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCACCCGTAGTAGTAGTAGTAATACCACCAGTA
C
C
A
C
C
C
G
T
A
G
T
A
G
T
A
G
T
A
G
T
A
A
T
A
C
C
A
C
C
A
G
T
A
Genes: 5LEEEEEC55E

Composition

Shiba Inu
55%
Labrador
27%
Grey Wolf
9%
Schnauzer
9%

Current Energy

Vitality -26 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador
Tail Grey Wolf
Legs Shiba Inu
Front Legs Shiba Inu
Head Shiba Inu
Ears Shiba Inu
Snout Shiba Inu
Mouth Schnauzer
Nose Labrador
Eyes Labrador
Color Shiba Inu