Hamlet Higgins Bitcoin Dog - Mix of Shiba Inu, Labrador BK, German Shepard, Schnauzer, Grey Wolf and Yorkshire Terrier

Achievements

None
Hamlet Higgins
My name is Hamlet Higgins and I do tricks. Dragging my butt on the carpet feels so good. I wish my human would stop putting clothes on me. Don't try to cover my flawless fur! I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!
  • Purity 11%
  • Age 29 months
  • Racing Exp 0
  • Shiba Inu 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCACCCGCATCAGTAGTATCAATAGTATTAATA
G
C
A
C
C
C
G
C
A
T
C
A
G
T
A
G
T
A
T
C
A
A
T
A
G
T
A
T
T
A
A
T
A
Genes: 6L67EE7CEFC

Composition

Shiba Inu
27%
Labrador BK
18%
German Shepard
18%
Schnauzer
18%
Grey Wolf
9%
Yorkshire Terrier
9%

Current Energy

Vitality -1 points
Lunar Effect +2 points

Traits Breakdown

Body Labrador BK
Tail Grey Wolf
Legs Labrador BK
Front Legs German Shepard
Head Shiba Inu
Ears Shiba Inu
Snout German Shepard
Mouth Schnauzer
Nose Shiba Inu
Eyes Yorkshire Terrier
Color Schnauzer