Miley Mileena Digital Cryptocurrency Dog - Mix of Shiba Inu, Labrador, German Shepard and St. Bernard
Miley Mileena
  • Purity 32%
  • Age 13 months
  • Racing Exp 17
  • Shiba Inu 55%
  • Gold medal 1 Silver medal 1 Bronze medal 0
  • 4 races
  • Gen 3
Depressed & Snaillike

Achievements

Racer

Bio

I run with a pack in the data warehouse. I don't mind sharing my bed with someone I just met, if we can cuddle. My favorite sport is catching treats my human throws! Forget plastic hotdogs...I'm into the classic chew toys like slippers. Ever play 'catch' with two humans then it turns into 'keep away'? Hate that.

Racing Stats

Ran 4 races
  • 1 1 0
 Best Time15.78 sec
Rank 94  RacingĀ *** Pts
50.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCATGAGTATCATCAGTAGTACCAGTAGTAGTA
C
C
A
T
G
A
G
T
A
T
C
A
T
C
A
G
T
A
G
T
A
C
C
A
G
T
A
G
T
A
G
T
A
Genes: 5BE77EE5EEE

Composition

Shiba Inu
55%
Labrador
18%
German Shepard
18%
St. Bernard
9%

Current Energy

Vitality -3 points
Lunar Effect -12 points

Traits Breakdown

Body Labrador
Tail St. Bernard
Legs Shiba Inu
Front Legs German Shepard
Head German Shepard
Ears Shiba Inu
Snout Shiba Inu
Mouth Labrador
Nose Shiba Inu
Eyes Shiba Inu
Color Shiba Inu

Parents

No Children

Photos

cryptocurrency doggy race crypto pet race
Gift