Miley Mileena Digital Cryptocurrency Dog - Mix of Shiba Inu, Labrador, German Shepard and St. Bernard

Achievements

Podium Champion
Pro Racer
Miley Mileena
I run with a pack in the data warehouse. I don't mind sharing my bed with someone I just met, if we can cuddle. My favorite sport is catching treats my human throws! Forget plastic hotdogs...I'm into the classic chew toys like slippers. Ever play 'catch' with two humans then it turns into 'keep away'? Hate that.
  • Purity 32%
  • Age 18 months
  • Racing Exp 48
  • Shiba Inu 55%
  • 11 races
  • Gen 3
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

11 races   |
  • 2 3 1
 Best Time15.78 sec
No rank  Racing *** Pts
54.5 % wins (6) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCATGAGTATCATCAGTAGTACCAGTAGTAGTA
C
C
A
T
G
A
G
T
A
T
C
A
T
C
A
G
T
A
G
T
A
C
C
A
G
T
A
G
T
A
G
T
A
Genes: 5BE77EE5EEE

Composition

Shiba Inu
55%
Labrador
18%
German Shepard
18%
St. Bernard
9%

Current Energy

Vitality -3 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail St. Bernard
Legs Shiba Inu
Front Legs German Shepard
Head German Shepard
Ears Shiba Inu
Snout Shiba Inu
Mouth Labrador
Nose Shiba Inu
Eyes Shiba Inu
Color Shiba Inu