Yeller Yin Litecoin Dog - Mix of Shiba Inu, Labrador, Labrador BK, German Shepard and Pitbull terrier
Yeller Yin
  • Purity 23%
  • Age 44 days
  • Racing Exp 0
  • Shiba Inu 45%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Sad & Tardy

Achievements

None

Bio

Sometimes I forget where I buried my bone. My favorite thing is to sit in my humans' laps while they are trying to read or drive. I don't like having to stay in the car when my people go inside. I am on a mission to sniff all the butts in the world. ALL the butts.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCAGTAGCAGCATCATCCGTACCAGTAGTAGTA
C
C
A
G
T
A
G
C
A
G
C
A
T
C
A
T
C
C
G
T
A
C
C
A
G
T
A
G
T
A
G
T
A
Genes: 5E667NE5EEE

Composition

Shiba Inu
45%
Labrador
18%
Labrador BK
18%
German Shepard
9%
Pitbull terrier
9%

Current Energy

Vitality +49 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Shiba Inu
Legs Labrador BK
Front Legs Labrador BK
Head German Shepard
Ears Pitbull terrier
Snout Shiba Inu
Mouth Labrador
Nose Shiba Inu
Eyes Shiba Inu
Color Shiba Inu