Yeller Yin Litecoin Dog - Mix of Shiba Inu, Labrador, Labrador BK, German Shepard and Pitbull terrier

Achievements

None
Yeller Yin
Sometimes I forget where I buried my bone. My favorite thing is to sit in my humans' laps while they are trying to read or drive. I don't like having to stay in the car when my people go inside. I am on a mission to sniff all the butts in the world. ALL the butts.
  • Purity 23%
  • Age 8 months
  • Racing Exp 0
  • Shiba Inu 45%
  • 0 races
  • Gen 4
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCAGTAGCAGCATCATCCGTACCAGTAGTAGTA
C
C
A
G
T
A
G
C
A
G
C
A
T
C
A
T
C
C
G
T
A
C
C
A
G
T
A
G
T
A
G
T
A
Genes: 5E667NE5EEE

Composition

Shiba Inu
45%
Labrador
18%
Labrador BK
18%
German Shepard
9%
Pitbull terrier
9%

Current Energy

Vitality +3 points
Lunar Effect +8 points

Traits Breakdown

Body Labrador
Tail Shiba Inu
Legs Labrador BK
Front Legs Labrador BK
Head German Shepard
Ears Pitbull terrier
Snout Shiba Inu
Mouth Labrador
Nose Shiba Inu
Eyes Shiba Inu
Color Shiba Inu