Andromeda Archer Litecoin Dog - Mix of Labrador BK, Labrador, Shiba Inu, Border Collie, Pitbull terrier, Dachshund, Golder Retriever, German Shepard, Rottweiler and Pug
Andromeda Archer
  • Purity 3%
  • Age 15 months
  • Racing Exp 3
  • Labrador BK 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 3 races
  • Gen 1
Sad & Slothful

Achievements

Racer

Bio

Andromeda Archer here. Wanna play? I am a web of clouds kind of dog. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. Oh, go ahead. Pet me. I know you want to. I like to respond to sad puppy eyes with sad puppy eyes of my own.

Racing Stats

Ran 3 races
  • 0 0 0
 Best Time16.13 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCAGTAGCAGCATACTCCGGAAGATCACACGAA
C
C
A
G
T
A
G
C
A
G
C
A
T
A
C
T
C
C
G
G
A
A
G
A
T
C
A
C
A
C
G
A
A
Genes: 5E66JNA87H2

Composition

Labrador BK
18%
Labrador
9%
Shiba Inu
9%
Border Collie
9%
Pitbull terrier
9%
Dachshund
9%
Golder Retriever
9%
German Shepard
9%
Rottweiler
9%
Pug
9%

Current Energy

Vitality +1 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador
Tail Shiba Inu
Legs Labrador BK
Front Legs Labrador BK
Head Border Collie
Ears Pitbull terrier
Snout Dachshund
Mouth Golder Retriever
Nose German Shepard
Eyes Rottweiler
Color Pug