Andromeda Archer Litecoin Dog - Mix of Labrador BK, Labrador, Shiba Inu, Border Collie, Pitbull terrier, Dachshund, Golder Retriever, German Shepard, Rottweiler and Pug

Achievements

Racer
Andromeda Archer
Andromeda Archer here. Wanna play? I am a web of clouds kind of dog. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. Oh, go ahead. Pet me. I know you want to. I like to respond to sad puppy eyes with sad puppy eyes of my own.
  • Purity 3%
  • Age 21 months
  • Racing Exp 3
  • Labrador BK 18%
  • 3 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
3 races    Best Time16.13 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCAGTAGCAGCATACTCCGGAAGATCACACGAA
C
C
A
G
T
A
G
C
A
G
C
A
T
A
C
T
C
C
G
G
A
A
G
A
T
C
A
C
A
C
G
A
A
Genes: 5E66JNA87H2

Composition

Labrador BK
18%
Labrador
9%
Shiba Inu
9%
Border Collie
9%
Pitbull terrier
9%
Dachshund
9%
Golder Retriever
9%
German Shepard
9%
Rottweiler
9%
Pug
9%

Current Energy

Vitality +1 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador
Tail Shiba Inu
Legs Labrador BK
Front Legs Labrador BK
Head Border Collie
Ears Pitbull terrier
Snout Dachshund
Mouth Golder Retriever
Nose German Shepard
Eyes Rottweiler
Color Pug