Cammy Codi Litecoin Dog - Mix of French Bulldog, Boxer, Corgi, German Shepard, Yorkshire Terrier, Grey Wolf, Golder Retriever and Labrador
Cammy Codi
  • Purity 6%
  • Age 17 months
  • Racing Exp 38
  • French Bulldog 18%
  • Gold medal 1 Silver medal 4 Bronze medal 0
  • 7 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Wassup? Yo, call me Cammy Codi. I keep my well-built figure with zeros and ones. I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! Being able to lick myself is nice, but I want to find my special someone.

Racing Stats

Ran 7 races
  • 1 4 0
 Best Time15.78 sec
Rank 20  RacingĀ *** Pts
71.4 % wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CGACGATCATTAAACAGCCCCAGACCAAGCAAC
C
G
A
C
G
A
T
C
A
T
T
A
A
A
C
A
G
C
C
C
C
A
G
A
C
C
A
A
G
C
A
A
C
Genes: 997FGOL85OG

Composition

French Bulldog
18%
Boxer
18%
Corgi
18%
German Shepard
9%
Yorkshire Terrier
9%
Grey Wolf
9%
Golder Retriever
9%
Labrador
9%

Current Energy

Vitality -34 points
Lunar Effect +6 points

Traits Breakdown

Body French Bulldog
Tail French Bulldog
Legs German Shepard
Front Legs Yorkshire Terrier
Head Boxer
Ears Corgi
Snout Grey Wolf
Mouth Golder Retriever
Nose Labrador
Eyes Corgi
Color Boxer