Dee Digger Litecoin Dog - Mix of Pug, Golder Retriever, Poodle, Schnauzer, Rottweiler, Corgi, Labrador and Beagle

Achievements

None
Dee Digger
Dee Digger here, let's shake. I like never worrying about my dog poo. I've got people for that. If I can't reach it to clean it myself, it doesn't need cleaning! My human's feet are definitely the greatest smell ever. Especially after a long day at work! I want to find a mate who enjoys dog parks as much as I do.
  • Purity 4%
  • Age 4 months
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAAGAATACACGAAAGCGACCCACTAAGAGAC
G
A
A
A
G
A
A
T
A
C
A
C
G
A
A
A
G
C
G
A
C
C
C
A
C
T
A
A
G
A
G
A
C
Genes: 28CH2OI5D8I

Composition

Pug
18%
Golder Retriever
18%
Poodle
18%
Schnauzer
9%
Rottweiler
9%
Corgi
9%
Labrador
9%
Beagle
9%

Current Energy

Vitality -51 points
Lunar Effect -2 points

Traits Breakdown

Body Pug
Tail Golder Retriever
Legs Schnauzer
Front Legs Rottweiler
Head Pug
Ears Corgi
Snout Poodle
Mouth Labrador
Nose Beagle
Eyes Golder Retriever
Color Poodle