Kane Kiva Litecoin Dog - Mix of French Bulldog, Pug, Corgi, German Shepard, Yorkshire Terrier, Boxer, Border Collie and Labrador
Kane Kiva
  • Purity 6%
  • Age 34 months
  • Racing Exp 0
  • French Bulldog 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Sad & Slothful

Achievements

None

Bio

Kane Kiva here, let's shake. I like never worrying about my dog poo. I've got people for that. If I can't reach it to clean it myself, it doesn't need cleaning! My human's feet are definitely the greatest smell ever. Especially after a long day at work! I want to find a mate who enjoys dog parks as much as I do.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0% wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CGAGAATCATTAAACAGCGAATACCCAAGCCGA
C
G
A
G
A
A
T
C
A
T
T
A
A
A
C
A
G
C
G
A
A
T
A
C
C
C
A
A
G
C
C
G
A
Genes: 927FGO2J5O9

Composition

French Bulldog
18%
Pug
18%
Corgi
18%
German Shepard
9%
Yorkshire Terrier
9%
Boxer
9%
Border Collie
9%
Labrador
9%

Current Energy

Vitality -37 points
Lunar Effect +2 points

Traits Breakdown

Body French Bulldog
Tail Pug
Legs German Shepard
Front Legs Yorkshire Terrier
Head Boxer
Ears Corgi
Snout Pug
Mouth Border Collie
Nose Labrador
Eyes Corgi
Color French Bulldog

Parents

No Children

Gift