Eli Eleanor Litecoin Dog - Mix of Pug, Poodle, Husky, Shiba Inu, St. Bernard, Grey Wolf, Border Collie, Labrador, Labrador BK and French Bulldog

Achievements

Pro Racer
Podium Champion
Master Champion
Eli Eleanor
Well hello, beautiful. My name's Eli Eleanor. I'm 100% digital, baby. I never met a leg I didn't want to hump. I love the smell of freshly cut grass. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. Just looking to sow some wild oats here...
  • Purity 1%
  • Age 39 months
  • Racing Exp 167
  • Pug 18%
  • 38 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

38 races   |
  • 1 12 10
 Best Time14.73 sec
No rank  Racing *** Pts
60.5 % wins (23) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACGAAACAGTATGACCCGAATACCCAGCACGA
G
A
C
G
A
A
A
C
A
G
T
A
T
G
A
C
C
C
G
A
A
T
A
C
C
C
A
G
C
A
C
G
A
Genes: I24EBL2J569

Composition

Pug
18%
Poodle
9%
Husky
9%
Shiba Inu
9%
St. Bernard
9%
Grey Wolf
9%
Border Collie
9%
Labrador
9%
Labrador BK
9%
French Bulldog
9%

Current Energy

Vitality -41 points
Lunar Effect -8 points

Traits Breakdown

Body Poodle
Tail Pug
Legs Husky
Front Legs Shiba Inu
Head St. Bernard
Ears Grey Wolf
Snout Pug
Mouth Border Collie
Nose Labrador
Eyes Labrador BK
Color French Bulldog

Parents

Children

Photos

crypto doggy racing online doggy racing crypto dog race Litecoin dog race photo Litecoin doggy race photo online pet race photo Litecoin dog race photo online dog racing