Eli Eleanor Litecoin Dog - Mix of Pug, Poodle, Husky, Shiba Inu, St. Bernard, Grey Wolf, Border Collie, Labrador, Labrador BK and French Bulldog
Eli Eleanor
  • Purity 1%
  • Age 75 months
  • Racing Exp 105
  • Pug 18%
  • Gold medal 1 Silver medal 8 Bronze medal 5
  • 25 races
  • Gen 0
Depressed & Snaillike

Achievements

Pro Racer
Podium Champion
Master Champion

Bio

Well hello, beautiful. My name's Eli Eleanor. I'm 100% digital, baby. I never met a leg I didn't want to hump. I love the smell of freshly cut grass. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. Just looking to sow some wild oats here...

Racing Stats

Ran 25 races
  • 1 8 5
 Best Time14.73 sec
No rank  RacingĀ *** Pts
56.0% wins (14) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GACGAAACAGTATGACCCGAATACCCAGCACGA
G
A
C
G
A
A
A
C
A
G
T
A
T
G
A
C
C
C
G
A
A
T
A
C
C
C
A
G
C
A
C
G
A
Genes: I24EBL2J569

Composition

Pug
18%
Poodle
9%
Husky
9%
Shiba Inu
9%
St. Bernard
9%
Grey Wolf
9%
Border Collie
9%
Labrador
9%
Labrador BK
9%
French Bulldog
9%

Current Energy

Vitality -41 points
Lunar Effect -8 points

Traits Breakdown

Body Poodle
Tail Pug
Legs Husky
Front Legs Shiba Inu
Head St. Bernard
Ears Grey Wolf
Snout Pug
Mouth Border Collie
Nose Labrador
Eyes Labrador BK
Color French Bulldog

Parents

Children

Photos

Litecoin dog racing online dog race results cryptocurrency dog racing podium crypto dog racing online pet racing photo virtual pet race virtual dog race podium virtual canine race results
Gift