Buzzy Baller Crypto Game Dog - Mix of Labrador BK, Labrador, Shiba Inu, Border Collie, Pitbull terrier, Dachshund, Poodle, German Shepard, Rottweiler and Pug

Achievements

Racer
Buzzy Baller
Baby, I'm made from the same stuff as dreams. I don't understand why my human tries to give me tap water. I expect filtered and distilled! I've been looking for love in all the wrong places... I enjoy staying active, and running circles around puppies and young children. If we can run as a pack for a while, I'm open to that.
  • Purity 3%
  • Age 20 months
  • Racing Exp 9
  • Labrador BK 18%
  • 3 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
3 races    Best Time15.90 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCAGTAGCAGCATACTCCGGAGACTCACACGAA
C
C
A
G
T
A
G
C
A
G
C
A
T
A
C
T
C
C
G
G
A
G
A
C
T
C
A
C
A
C
G
A
A
Genes: 5E66JNAI7H2

Composition

Labrador BK
18%
Labrador
9%
Shiba Inu
9%
Border Collie
9%
Pitbull terrier
9%
Dachshund
9%
Poodle
9%
German Shepard
9%
Rottweiler
9%
Pug
9%

Current Energy

Vitality +1 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador
Tail Shiba Inu
Legs Labrador BK
Front Legs Labrador BK
Head Border Collie
Ears Pitbull terrier
Snout Dachshund
Mouth Poodle
Nose German Shepard
Eyes Rottweiler
Color Pug