Buzzy Baller Crypto Game Dog - Mix of Labrador BK, Labrador, Shiba Inu, Border Collie, Pitbull terrier, Dachshund, Poodle, German Shepard, Rottweiler and Pug
Buzzy Baller
  • Purity 3%
  • Age 17 months
  • Racing Exp 20
  • Labrador BK 18%
  • Gold medal 1 Silver medal 1 Bronze medal 0
  • 7 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Baby, I'm made from the same stuff as dreams. I don't understand why my human tries to give me tap water. I expect filtered and distilled! I've been looking for love in all the wrong places... I enjoy staying active, and running circles around puppies and young children. If we can run as a pack for a while, I'm open to that.

Racing Stats

Ran 7 races
  • 1 1 0
 Best Time15.90 sec
No rank  RacingĀ *** Pts
28.6 % wins (2) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCAGTAGCAGCATACTCCGGAGACTCACACGAA
C
C
A
G
T
A
G
C
A
G
C
A
T
A
C
T
C
C
G
G
A
G
A
C
T
C
A
C
A
C
G
A
A
Genes: 5E66JNAI7H2

Composition

Labrador BK
18%
Labrador
9%
Shiba Inu
9%
Border Collie
9%
Pitbull terrier
9%
Dachshund
9%
Poodle
9%
German Shepard
9%
Rottweiler
9%
Pug
9%

Current Energy

Vitality +1 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Shiba Inu
Legs Labrador BK
Front Legs Labrador BK
Head Border Collie
Ears Pitbull terrier
Snout Dachshund
Mouth Poodle
Nose German Shepard
Eyes Rottweiler
Color Pug