Adam Addie Bitcoin Game Dog - Mix of Labrador BK, Labrador, Border Collie, Boxer, Shiba Inu, Poodle, Beagle, Rottweiler and Pug
Adam Addie
  • Purity 8%
  • Age 13 months
  • Racing Exp 7
  • Labrador BK 27%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 2 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

They say my bite is worse than my bark. Shy dogs that tuck tail bore me. My favorite sport is catching treats my human throws! I like exploring off leash best.

Racing Stats

Ran 2 races
  • 0 0 1
 Best Time16.57 sec
No rank  RacingĀ *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCAGCAGCAGCATACAACGTAGACCTACACGAA
C
C
A
G
C
A
G
C
A
G
C
A
T
A
C
A
A
C
G
T
A
G
A
C
C
T
A
C
A
C
G
A
A
Genes: 5666JGEIDH2

Composition

Labrador BK
27%
Labrador
9%
Border Collie
9%
Boxer
9%
Shiba Inu
9%
Poodle
9%
Beagle
9%
Rottweiler
9%
Pug
9%

Current Energy

Vitality +1 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Labrador BK
Legs Labrador BK
Front Legs Labrador BK
Head Border Collie
Ears Boxer
Snout Shiba Inu
Mouth Poodle
Nose Beagle
Eyes Rottweiler
Color Pug

Parents

No Children

Photos

Litecoin dog racing
Gift