Adam Addie Bitcoin Game Dog - Mix of Labrador BK, Labrador, Border Collie, Boxer, Shiba Inu, Poodle, Beagle, Rottweiler and Pug

Achievements

Racer
Adam Addie
They say my bite is worse than my bark. Shy dogs that tuck tail bore me. My favorite sport is catching treats my human throws! I like exploring off leash best.
  • Purity 8%
  • Age 18 months
  • Racing Exp 13
  • Labrador BK 27%
  • 8 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 0 0 1
 Best Time16.57 sec
No rank  Racing *** Pts
12.5 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAGCAGCAGCATACAACGTAGACCTACACGAA
C
C
A
G
C
A
G
C
A
G
C
A
T
A
C
A
A
C
G
T
A
G
A
C
C
T
A
C
A
C
G
A
A
Genes: 5666JGEIDH2

Composition

Labrador BK
27%
Labrador
9%
Border Collie
9%
Boxer
9%
Shiba Inu
9%
Poodle
9%
Beagle
9%
Rottweiler
9%
Pug
9%

Current Energy

Vitality +1 points
Lunar Effect +8 points

Traits Breakdown

Body Labrador
Tail Labrador BK
Legs Labrador BK
Front Legs Labrador BK
Head Border Collie
Ears Boxer
Snout Shiba Inu
Mouth Poodle
Nose Beagle
Eyes Rottweiler
Color Pug

Parents

No Children

Photos

Bitcoin pet racing results