Pepe Puck Cryptocurrency Dog - Mix of Labrador BK, Rottweiler, Dachshund, Golder Retriever, Boxer, Shiba Inu, Pitbull terrier, Beagle and Poodle
Pepe Puck
  • Purity 5%
  • Age 13 months
  • Racing Exp 13
  • Labrador BK 18%
  • Gold medal 0 Silver medal 0 Bronze medal 2
  • 3 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! I'm looking for someone who is also playful, feisty and happy.

Racing Stats

Ran 3 races
  • 0 0 2
 Best Time15.15 sec
Rank 26  RacingĀ *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GGAGCAGCACACAGAAACGTATCCCTACACGAC
G
G
A
G
C
A
G
C
A
C
A
C
A
G
A
A
A
C
G
T
A
T
C
C
C
T
A
C
A
C
G
A
C
Genes: A66H8GENDHI

Composition

Labrador BK
18%
Rottweiler
18%
Dachshund
9%
Golder Retriever
9%
Boxer
9%
Shiba Inu
9%
Pitbull terrier
9%
Beagle
9%
Poodle
9%

Current Energy

Vitality -39 points
Lunar Effect -4 points

Traits Breakdown

Body Dachshund
Tail Labrador BK
Legs Labrador BK
Front Legs Rottweiler
Head Golder Retriever
Ears Boxer
Snout Shiba Inu
Mouth Pitbull terrier
Nose Beagle
Eyes Rottweiler
Color Poodle