Pepe Puck Cryptocurrency Dog - Mix of Labrador BK, Rottweiler, Dachshund, Golder Retriever, Boxer, Shiba Inu, Pitbull terrier, Beagle and Poodle

Achievements

Racer
Pepe Puck
I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! I'm looking for someone who is also playful, feisty and happy.
  • Purity 5%
  • Age 21 months
  • Racing Exp 13
  • Labrador BK 18%
  • 3 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 2
3 races    Best Time15.15 sec
No rank  Racing *** Coins
66.7 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGAGCAGCACACAGAAACGTATCCCTACACGAC
G
G
A
G
C
A
G
C
A
C
A
C
A
G
A
A
A
C
G
T
A
T
C
C
C
T
A
C
A
C
G
A
C
Genes: A66H8GENDHI

Composition

Labrador BK
18%
Rottweiler
18%
Dachshund
9%
Golder Retriever
9%
Boxer
9%
Shiba Inu
9%
Pitbull terrier
9%
Beagle
9%
Poodle
9%

Current Energy

Vitality -39 points
Lunar Effect -6 points

Traits Breakdown

Body Dachshund
Tail Labrador BK
Legs Labrador BK
Front Legs Rottweiler
Head Golder Retriever
Ears Boxer
Snout Shiba Inu
Mouth Pitbull terrier
Nose Beagle
Eyes Rottweiler
Color Poodle

Parents

Children

Photos

crypto dog race photo online pet racing photo Bitcoin dog race photo online doggy race crypto pet racing Bitcoin canine racing Bitcoin canine racing Litecoin pet race