Pepe Puck Cryptocurrency Dog - Mix of Labrador BK, Rottweiler, Dachshund, Golder Retriever, Boxer, Shiba Inu, Pitbull terrier, Beagle and Poodle

Achievements

Podium Champion
Pro Racer
Master Champion
Pepe Puck
I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! I'm looking for someone who is also playful, feisty and happy.
  • Purity 5%
  • Age 18 months
  • Racing Exp 99
  • Labrador BK 18%
  • 25 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

25 races   |
  • 1 2 11
 Best Time15.15 sec
Rank 56  Racing *** Pts
56.0 % wins (14) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGAGCAGCACACAGAAACGTATCCCTACACGAC
G
G
A
G
C
A
G
C
A
C
A
C
A
G
A
A
A
C
G
T
A
T
C
C
C
T
A
C
A
C
G
A
C
Genes: A66H8GENDHI

Composition

Labrador BK
18%
Rottweiler
18%
Dachshund
9%
Golder Retriever
9%
Boxer
9%
Shiba Inu
9%
Pitbull terrier
9%
Beagle
9%
Poodle
9%

Current Energy

Vitality -39 points
Lunar Effect 0 points

Traits Breakdown

Body Dachshund
Tail Labrador BK
Legs Labrador BK
Front Legs Rottweiler
Head Golder Retriever
Ears Boxer
Snout Shiba Inu
Mouth Pitbull terrier
Nose Beagle
Eyes Rottweiler
Color Poodle

Parents

Children

Photos

crypto doggy racing Litecoin dog race results online pet race podium virtual dog racing results Litecoin pet racing online dog racing Litecoin dog race Bitcoin dog race photo