Abel Aries Crypto Dog - Mix of Labrador, Pitbull terrier, Labrador BK, Shiba Inu, Border Collie, Poodle and Pug

Achievements

Racer
Abel Aries
Air Bud is definitely my favorite movie. What a role model! I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew. Sometimes I forget where I buried my bone. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again!
  • Purity 9%
  • Age 18 months
  • Racing Exp 37
  • Labrador 18%
  • 9 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

9 races   |
  • 0 3 2
 Best Time15.37 sec
No rank  Racing *** Pts
55.6 % wins (5) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCATCCGCAGCATACTCCGACCCAGTAGTAGAA
C
C
A
T
C
C
G
C
A
G
C
A
T
A
C
T
C
C
G
A
C
C
C
A
G
T
A
G
T
A
G
A
A
Genes: 5N66JNI5EE2

Composition

Labrador
18%
Pitbull terrier
18%
Labrador BK
18%
Shiba Inu
18%
Border Collie
9%
Poodle
9%
Pug
9%

Current Energy

Vitality +6 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador
Tail Pitbull terrier
Legs Labrador BK
Front Legs Labrador BK
Head Border Collie
Ears Pitbull terrier
Snout Poodle
Mouth Labrador
Nose Shiba Inu
Eyes Shiba Inu
Color Pug