Sir-Barks-Alot Sparky Litecoin Game Dog - Mix of Shiba Inu, Labrador BK, Labrador, Pug, German Shepard, Corgi and Dachshund

Achievements

Racer
Sir-Barks-Alot Sparky
I'm not into dog collars, unless you're into S & M. I don't understand why I like smelling butts... My idea of romance would be to stroll through in the dog park then share a meaty bone with you. I enjoy staying active, and running circles around puppies and young children.
  • Purity 16%
  • Age 3 months
  • Racing Exp 25
  • Shiba Inu 36%
  • 8 races
  • Gen 5
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 0 2 1
 Best Time16.35 sec
No rank  Racing *** Pts
37.5 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAGAAGCAGCATCAAGCGTAGGAGTAGTAGTA
C
C
A
G
A
A
G
C
A
G
C
A
T
C
A
A
G
C
G
T
A
G
G
A
G
T
A
G
T
A
G
T
A
Genes: 52667OEAEEE

Composition

Shiba Inu
36%
Labrador BK
18%
Labrador
9%
Pug
9%
German Shepard
9%
Corgi
9%
Dachshund
9%

Current Energy

Vitality +3 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Pug
Legs Labrador BK
Front Legs Labrador BK
Head German Shepard
Ears Corgi
Snout Shiba Inu
Mouth Dachshund
Nose Shiba Inu
Eyes Shiba Inu
Color Shiba Inu