Sir-Barks-Alot Sparky Litecoin Game Dog - Mix of Shiba Inu, Labrador BK, Labrador, Pug, German Shepard, Corgi and Dachshund
Sir-Barks-Alot Sparky
  • Purity 16%
  • Age 36 months
  • Racing Exp 11
  • Shiba Inu 36%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 6 races
  • Gen 5
Sad & Snaillike

Achievements

Racer

Bio

I'm not into dog collars, unless you're into S & M. I don't understand why I like smelling butts... My idea of romance would be to stroll through in the dog park then share a meaty bone with you. I enjoy staying active, and running circles around puppies and young children.

Racing Stats

Ran 6 races
  • 0 0 1
 Best Time16.35 sec
No rank  RacingĀ *** Pts
16.7% wins (1) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCAGAAGCAGCATCAAGCGTAGGAGTAGTAGTA
C
C
A
G
A
A
G
C
A
G
C
A
T
C
A
A
G
C
G
T
A
G
G
A
G
T
A
G
T
A
G
T
A
Genes: 52667OEAEEE

Composition

Shiba Inu
36%
Labrador BK
18%
Labrador
9%
Pug
9%
German Shepard
9%
Corgi
9%
Dachshund
9%

Current Energy

Vitality +3 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador
Tail Pug
Legs Labrador BK
Front Legs Labrador BK
Head German Shepard
Ears Corgi
Snout Shiba Inu
Mouth Dachshund
Nose Shiba Inu
Eyes Shiba Inu
Color Shiba Inu