Misha Miles Crypto Dog - Mix of Corgi, Pug, German Shepard, Labrador BK, Boxer, Dachshund and Husky

Achievements

Racer
Misha Miles
How YOU doin'? Misha Miles here. In the big data server, I sorta rule. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! Don't bother contacting me if you like cats. If you are looking for companionship without commitment, so am I.
  • Purity 11%
  • Age 4 months
  • Racing Exp 26
  • Corgi 27%
  • 6 races
  • Gen 4
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

6 races   |
  • 2 1 0
 Best Time16.53 sec
No rank  Racing *** Pts
50.0 % wins (3) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCAGAAAACTCATCAAGCGAAGGAAGCAGCACA
G
C
A
G
A
A
A
A
C
T
C
A
T
C
A
A
G
C
G
A
A
G
G
A
A
G
C
A
G
C
A
C
A
Genes: 62G77O2AOO4

Composition

Corgi
27%
Pug
18%
German Shepard
18%
Labrador BK
9%
Boxer
9%
Dachshund
9%
Husky
9%

Current Energy

Vitality -13 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Pug
Legs Boxer
Front Legs German Shepard
Head German Shepard
Ears Corgi
Snout Pug
Mouth Dachshund
Nose Corgi
Eyes Corgi
Color Husky