Misha Miles Crypto Dog - Mix of Corgi, Pug, German Shepard, Labrador BK, Boxer, Dachshund and Husky

Achievements

None
Misha Miles
How YOU doin'? Misha Miles here. In the big data server, I sorta rule. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! Don't bother contacting me if you like cats. If you are looking for companionship without commitment, so am I.
  • Purity 11%
  • Age 8 months
  • Racing Exp 0
  • Corgi 27%
  • 0 races
  • Gen 4
Make him happy share it to your friend*
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGAAAACTCATCAAGCGAAGGAAGCAGCACA
G
C
A
G
A
A
A
A
C
T
C
A
T
C
A
A
G
C
G
A
A
G
G
A
A
G
C
A
G
C
A
C
A
Genes: 62G77O2AOO4

Composition

Corgi
27%
Pug
18%
German Shepard
18%
Labrador BK
9%
Boxer
9%
Dachshund
9%
Husky
9%

Current Energy

Vitality -13 points
Lunar Effect +14 points

Traits Breakdown

Body Labrador BK
Tail Pug
Legs Boxer
Front Legs German Shepard
Head German Shepard
Ears Corgi
Snout Pug
Mouth Dachshund
Nose Corgi
Eyes Corgi
Color Husky