Misha Miles Crypto Dog - Mix of Corgi, Pug, German Shepard, Labrador BK, Boxer, Dachshund and Husky
Misha Miles
  • Purity 11%
  • Age 44 days
  • Racing Exp 0
  • Corgi 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 4
Sad & Tardy

Achievements

None

Bio

How YOU doin'? Misha Miles here. In the big data server, I sorta rule. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! Don't bother contacting me if you like cats. If you are looking for companionship without commitment, so am I.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GCAGAAAACTCATCAAGCGAAGGAAGCAGCACA
G
C
A
G
A
A
A
A
C
T
C
A
T
C
A
A
G
C
G
A
A
G
G
A
A
G
C
A
G
C
A
C
A
Genes: 62G77O2AOO4

Composition

Corgi
27%
Pug
18%
German Shepard
18%
Labrador BK
9%
Boxer
9%
Dachshund
9%
Husky
9%

Current Energy

Vitality +33 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Pug
Legs Boxer
Front Legs German Shepard
Head German Shepard
Ears Corgi
Snout Pug
Mouth Dachshund
Nose Corgi
Eyes Corgi
Color Husky