Gabe Gaston Bitcoin Dog - Mix of Boxer, Border Collie, Corgi, Pug, Dachshund, Labrador BK and Husky

Achievements

None
Gabe Gaston
How's it going? I'm Gabe Gaston. This dawg chases mice in a big data warehouse. Chasing anything that will run is so much fun, I could do that all day. I'm going kill that damn Nyan Cat if I can catch it. It doesn't matter to me which team I play for... I just like tail.
  • Purity 11%
  • Age 9 months
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 3
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACGAAAACAACAACAGCTACGGAGCAAGCACA
T
A
C
G
A
A
A
A
C
A
A
C
A
A
C
A
G
C
T
A
C
G
G
A
G
C
A
A
G
C
A
C
A
Genes: J2GGGOJA6O4

Composition

Boxer
27%
Border Collie
18%
Corgi
18%
Pug
9%
Dachshund
9%
Labrador BK
9%
Husky
9%

Current Energy

Vitality -44 points
Lunar Effect -2 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Boxer
Front Legs Boxer
Head Boxer
Ears Corgi
Snout Border Collie
Mouth Dachshund
Nose Labrador BK
Eyes Corgi
Color Husky