Cid Corky Digital Cryptocurrency Dog - Mix of Border Collie, Husky, Pug, Labrador, Rottweiler, Grey Wolf, Maltese, Dachshund and St. Bernard

Achievements

Racer
Cid Corky
Hello there, my name is Cid Corky. Sometimes I just have to roll in something dead. Chasing anything that will run is so much fun, I could do that all day. When I can break free, I enjoy exploring my neighborhood without my human. Peanut butter is delish but I HATE when it sticks to the roof of my mouth.
  • Purity 3%
  • Age 8 months
  • Racing Exp 7
  • Border Collie 18%
  • 2 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
2 races    Best Time15.77 sec
No rank  Racing *** Coins
50.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACGAATACCCACACCCCACCGGAACATGAACA
T
A
C
G
A
A
T
A
C
C
C
A
C
A
C
C
C
C
A
C
C
G
G
A
A
C
A
T
G
A
A
C
A
Genes: J2J5HLKA4B4

Composition

Border Collie
18%
Husky
18%
Pug
9%
Labrador
9%
Rottweiler
9%
Grey Wolf
9%
Maltese
9%
Dachshund
9%
St. Bernard
9%

Current Energy

Vitality -11 points
Lunar Effect -2 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Border Collie
Front Legs Labrador
Head Rottweiler
Ears Grey Wolf
Snout Maltese
Mouth Dachshund
Nose Husky
Eyes St. Bernard
Color Husky