Cid Corky Digital Cryptocurrency Dog - Mix of Border Collie, Husky, Pug, Labrador, Rottweiler, Grey Wolf, Maltese, Dachshund and St. Bernard

Achievements

Podium Champion
Pro Racer
Master Champion
Cid Corky
Hello there, my name is Cid Corky. Sometimes I just have to roll in something dead. Chasing anything that will run is so much fun, I could do that all day. When I can break free, I enjoy exploring my neighborhood without my human. Peanut butter is delish but I HATE when it sticks to the roof of my mouth.
  • Purity 3%
  • Age 6 months
  • Racing Exp 94
  • Border Collie 18%
  • 25 races
  • Gen 0
Share it to make him Happy!
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

25 races   |
  • 2 5 5
 Best Time15.05 sec
No rank  Racing *** Pts
48.0 % wins (12) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACGAATACCCACACCCCACCGGAACATGAACA
T
A
C
G
A
A
T
A
C
C
C
A
C
A
C
C
C
C
A
C
C
G
G
A
A
C
A
T
G
A
A
C
A
Genes: J2J5HLKA4B4

Composition

Border Collie
18%
Husky
18%
Pug
9%
Labrador
9%
Rottweiler
9%
Grey Wolf
9%
Maltese
9%
Dachshund
9%
St. Bernard
9%

Current Energy

Vitality -11 points
Lunar Effect -8 points

Traits Breakdown

Body Border Collie
Tail Pug
Legs Border Collie
Front Legs Labrador
Head Rottweiler
Ears Grey Wolf
Snout Maltese
Mouth Dachshund
Nose Husky
Eyes St. Bernard
Color Husky