Cisco C3Po Litecoin Game Dog - Mix of Maltese, St. Bernard, French Bulldog, Golder Retriever, Poodle, Boxer, Schnauzer, Shiba Inu and Corgi

Achievements

None
Cisco C3Po
Hi! My name is Cisco C3Po. Ima cyber dog. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! The place I like most in the world is curled up in my human's bed, hogging all the covers! I want to find a mate who enjoys dog parks as much as I do.
  • Purity 5%
  • Age 3 months
  • Racing Exp 0
  • Maltese 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGAACCAGAGACAACATAGTAAGCACCTGATGA
C
G
A
A
C
C
A
G
A
G
A
C
A
A
C
A
T
A
G
T
A
A
G
C
A
C
C
T
G
A
T
G
A
Genes: 9K8IGCEOKBB

Composition

Maltese
18%
St. Bernard
18%
French Bulldog
9%
Golder Retriever
9%
Poodle
9%
Boxer
9%
Schnauzer
9%
Shiba Inu
9%
Corgi
9%

Current Energy

Vitality -21 points
Lunar Effect +4 points

Traits Breakdown

Body French Bulldog
Tail Maltese
Legs Golder Retriever
Front Legs Poodle
Head Boxer
Ears Schnauzer
Snout Shiba Inu
Mouth Corgi
Nose Maltese
Eyes St. Bernard
Color St. Bernard