Ace Anna Litecoin Game Dog - Mix of Yorkshire Terrier, Border Collie, Pug, Poodle, Maltese, Dachshund, Corgi and St. Bernard
Ace Anna
  • Purity 9%
  • Age 16 days
  • Racing Exp 32
  • Yorkshire Terrier 27%
  • Gold medal 2 Silver medal 1 Bronze medal 1
  • 7 races
  • Gen 2
Sad & Tardy

Achievements

Racer
Podium Champion

Bio

Hi! My name is Ace Anna. Ima cyber dog. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! The place I like most in the world is curled up in my human's bed, hogging all the covers! I want to find a mate who enjoys dog parks as much as I do.

Racing Stats

Ran 7 races
  • 2 1 1
 Best Time14.73 sec
Rank 86  RacingĀ *** Pts
57.1 % wins (4) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TTAGAATACTACTTAGACACCGGAAGCTGATTA
T
T
A
G
A
A
T
A
C
T
A
C
T
T
A
G
A
C
A
C
C
G
G
A
A
G
C
T
G
A
T
T
A
Genes: F2JJFIKAOBF

Composition

Yorkshire Terrier
27%
Border Collie
18%
Pug
9%
Poodle
9%
Maltese
9%
Dachshund
9%
Corgi
9%
St. Bernard
9%

Current Energy

Vitality +42 points
Lunar Effect -6 points

Traits Breakdown

Body Yorkshire Terrier
Tail Pug
Legs Border Collie
Front Legs Border Collie
Head Yorkshire Terrier
Ears Poodle
Snout Maltese
Mouth Dachshund
Nose Corgi
Eyes St. Bernard
Color Yorkshire Terrier

Parents

No Children

Photos

Litecoin canine racing results crypto canine racing photo cryptocurrency doggy race crypto doggy racing
Gift