Nibby-Nose Nana Cryptocurrency Dog - Mix of Yorkshire Terrier, Corgi, Shiba Inu, Maltese, Poodle, Boxer and Pitbull terrier

Achievements

Racer
Nibby-Nose Nana
Hi! My name is Nibby-Nose Nana. Removing excess stuffing from pillows is my favorite hobby. I'll outrun you for the ball if I can...that's just how I roll. I really dislike stinky flea collars. I'm looking for someone who is also playful, feisty and happy.
  • Purity 11%
  • Age 26 months
  • Racing Exp 14
  • Yorkshire Terrier 27%
  • 3 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 0 1 1
 Best Time15.80 sec
No rank  Racing *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTAGTAAGCACCTTAGACAGCAACAGCTCCTTA
T
T
A
G
T
A
A
G
C
A
C
C
T
T
A
G
A
C
A
G
C
A
A
C
A
G
C
T
C
C
T
T
A
Genes: FEOKFIOGONF

Composition

Yorkshire Terrier
27%
Corgi
27%
Shiba Inu
9%
Maltese
9%
Poodle
9%
Boxer
9%
Pitbull terrier
9%

Current Energy

Vitality -60 points
Lunar Effect +16 points

Traits Breakdown

Body Yorkshire Terrier
Tail Shiba Inu
Legs Corgi
Front Legs Maltese
Head Yorkshire Terrier
Ears Poodle
Snout Corgi
Mouth Boxer
Nose Corgi
Eyes Pitbull terrier
Color Yorkshire Terrier