Louie Leisel Bitcoin Dog - Mix of Yorkshire Terrier, Poodle, Pug, Husky, Maltese, Labrador BK and Grey Wolf
Louie Leisel
  • Purity 11%
  • Age 17 months
  • Racing Exp 38
  • Yorkshire Terrier 27%
  • Gold medal 1 Silver medal 0 Bronze medal 4
  • 11 races
  • Gen 2
Depressed & Snaillike

Achievements

Racer

Bio

Louie Leisel here, let's shake. Nyan Cat is my best friend here in the cyberspace. My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I enjoy staying active, and running circles around puppies and young children. You scratch my belly and I'll scratch yours ;)

Racing Stats

Ran 11 races
  • 1 0 4
 Best Time15.05 sec
Rank 63  RacingĀ *** Pts
45.5 % wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TTAACAGACACCTTAGACGCACCCGAAGAATTA
T
T
A
A
C
A
G
A
C
A
C
C
T
T
A
G
A
C
G
C
A
C
C
C
G
A
A
G
A
A
T
T
A
Genes: F4IKFI6L22F

Composition

Yorkshire Terrier
27%
Poodle
18%
Pug
18%
Husky
9%
Maltese
9%
Labrador BK
9%
Grey Wolf
9%

Current Energy

Vitality -60 points
Lunar Effect -10 points

Traits Breakdown

Body Yorkshire Terrier
Tail Husky
Legs Poodle
Front Legs Maltese
Head Yorkshire Terrier
Ears Poodle
Snout Labrador BK
Mouth Grey Wolf
Nose Pug
Eyes Pug
Color Yorkshire Terrier