Toto Tails Litecoin Dog - Mix of Pug, Yorkshire Terrier, Husky, Maltese, Shiba Inu and Border Collie
Toto Tails
  • Purity 19%
  • Age 13 months
  • Racing Exp 15
  • Pug 36%
  • Gold medal 0 Silver medal 0 Bronze medal 2
  • 5 races
  • Gen 3
Depressed & Snaillike

Achievements

Racer

Bio

Howdy! I'm Toto Tails. I hate having to share my food dish... Little Bow Wow is my favorite musician. I just assume he's a dog... The smell of fresh manure to roll in makes me wild. As a perfectionist, I have to find just the right 'spot'.

Racing Stats

Ran 5 races
  • 0 0 2
 Best Time14.97 sec
Rank 68  RacingĀ *** Pts
40.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TTAGAAACAACCTTAGTATACGAAGAAGAATTA
T
T
A
G
A
A
A
C
A
A
C
C
T
T
A
G
T
A
T
A
C
G
A
A
G
A
A
G
A
A
T
T
A
Genes: F24KFEJ222F

Composition

Pug
36%
Yorkshire Terrier
27%
Husky
9%
Maltese
9%
Shiba Inu
9%
Border Collie
9%

Current Energy

Vitality -45 points
Lunar Effect +4 points

Traits Breakdown

Body Yorkshire Terrier
Tail Pug
Legs Husky
Front Legs Maltese
Head Yorkshire Terrier
Ears Shiba Inu
Snout Border Collie
Mouth Pug
Nose Pug
Eyes Pug
Color Yorkshire Terrier

Parents

No Children

Photos

Litecoin pet race photo virtual dog race results
Gift