Toto Tails Litecoin Dog - Mix of Pug, Yorkshire Terrier, Husky, Maltese, Shiba Inu and Border Collie

Achievements

Racer
Podium Champion
Toto Tails
Howdy! I'm Toto Tails. I hate having to share my food dish... Little Bow Wow is my favorite musician. I just assume he's a dog... The smell of fresh manure to roll in makes me wild. As a perfectionist, I have to find just the right 'spot'.
  • Purity 19%
  • Age 18 months
  • Racing Exp 84
  • Pug 36%
  • 32 races
  • Gen 3
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

32 races   |
  • 2 3 4
 Best Time14.97 sec
No rank  Racing *** Pts
28.1 % wins (9) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTAGAAACAACCTTAGTATACGAAGAAGAATTA
T
T
A
G
A
A
A
C
A
A
C
C
T
T
A
G
T
A
T
A
C
G
A
A
G
A
A
G
A
A
T
T
A
Genes: F24KFEJ222F

Composition

Pug
36%
Yorkshire Terrier
27%
Husky
9%
Maltese
9%
Shiba Inu
9%
Border Collie
9%

Current Energy

Vitality -45 points
Lunar Effect +8 points

Traits Breakdown

Body Yorkshire Terrier
Tail Pug
Legs Husky
Front Legs Maltese
Head Yorkshire Terrier
Ears Shiba Inu
Snout Border Collie
Mouth Pug
Nose Pug
Eyes Pug
Color Yorkshire Terrier