Toto Tails Litecoin Dog - Mix of Pug, Yorkshire Terrier, Husky, Maltese, Shiba Inu and Border Collie
Toto Tails
  • Purity 19%
  • Age 51 months
  • Racing Exp 58
  • Pug 36%
  • Gold medal 2 Silver medal 2 Bronze medal 3
  • 17 races
  • Gen 3
Depressed & Snaillike

Achievements

Racer
Podium Champion

Bio

Howdy! I'm Toto Tails. I hate having to share my food dish... Little Bow Wow is my favorite musician. I just assume he's a dog... The smell of fresh manure to roll in makes me wild. As a perfectionist, I have to find just the right 'spot'.

Racing Stats

Ran 17 races
  • 2 2 3
 Best Time14.97 sec
No rank  RacingĀ *** Pts
41.2% wins (7) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TTAGAAACAACCTTAGTATACGAAGAAGAATTA
T
T
A
G
A
A
A
C
A
A
C
C
T
T
A
G
T
A
T
A
C
G
A
A
G
A
A
G
A
A
T
T
A
Genes: F24KFEJ222F

Composition

Pug
36%
Yorkshire Terrier
27%
Husky
9%
Maltese
9%
Shiba Inu
9%
Border Collie
9%

Current Energy

Vitality -45 points
Lunar Effect 0 points

Traits Breakdown

Body Yorkshire Terrier
Tail Pug
Legs Husky
Front Legs Maltese
Head Yorkshire Terrier
Ears Shiba Inu
Snout Border Collie
Mouth Pug
Nose Pug
Eyes Pug
Color Yorkshire Terrier

Parents

No Children

Photos

cryptocurrency dog race podium crypto dog racing Litecoin pet race Bitcoin doggy racing podium virtual dog racing podium crypto pet racing podium crypto dog race photo
Gift