Bumper Bacchus Litecoin Dog - Mix of Pug, Border Collie, Husky, Poodle, Shiba Inu, St. Bernard, Labrador, Labrador BK, Grey Wolf and French Bulldog

Achievements

Racer
Bumper Bacchus
Bumper Bacchus here, let's shake. I'm not a bad dog, my data is just configured that way. I never met a leg I didn't want to hump. I am really into starting howling wars with the neighborhood dogs. I'm the loudest! I'm not looking to hook up forever, just to have a little fun.
  • Purity 3%
  • Age 41 months
  • Racing Exp 9
  • Pug 18%
  • 3 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
3 races    Best Time15.82 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACACAGACGTATGACCAGCACCCGAAGAACGA
T
A
C
A
C
A
G
A
C
G
T
A
T
G
A
C
C
A
G
C
A
C
C
C
G
A
A
G
A
A
C
G
A
Genes: J4IEB56L229

Composition

Pug
18%
Border Collie
9%
Husky
9%
Poodle
9%
Shiba Inu
9%
St. Bernard
9%
Labrador
9%
Labrador BK
9%
Grey Wolf
9%
French Bulldog
9%

Current Energy

Vitality -39 points
Lunar Effect -8 points

Traits Breakdown

Body Border Collie
Tail Husky
Legs Poodle
Front Legs Shiba Inu
Head St. Bernard
Ears Labrador
Snout Labrador BK
Mouth Grey Wolf
Nose Pug
Eyes Pug
Color French Bulldog