Bumper Bacchus Litecoin Dog - Mix of Pug, Border Collie, Husky, Poodle, Shiba Inu, St. Bernard, Labrador, Labrador BK, Grey Wolf and French Bulldog
Bumper Bacchus
  • Purity 3%
  • Age 37 months
  • Racing Exp 37
  • Pug 18%
  • Gold medal 0 Silver medal 3 Bronze medal 2
  • 9 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Bumper Bacchus here, let's shake. I'm not a bad dog, my data is just configured that way. I never met a leg I didn't want to hump. I am really into starting howling wars with the neighborhood dogs. I'm the loudest! I'm not looking to hook up forever, just to have a little fun.

Racing Stats

Ran 9 races
  • 0 3 2
 Best Time15.82 sec
No rank  RacingĀ *** Pts
55.6 % wins (5) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACACAGACGTATGACCAGCACCCGAAGAACGA
T
A
C
A
C
A
G
A
C
G
T
A
T
G
A
C
C
A
G
C
A
C
C
C
G
A
A
G
A
A
C
G
A
Genes: J4IEB56L229

Composition

Pug
18%
Border Collie
9%
Husky
9%
Poodle
9%
Shiba Inu
9%
St. Bernard
9%
Labrador
9%
Labrador BK
9%
Grey Wolf
9%
French Bulldog
9%

Current Energy

Vitality -39 points
Lunar Effect -8 points

Traits Breakdown

Body Border Collie
Tail Husky
Legs Poodle
Front Legs Shiba Inu
Head St. Bernard
Ears Labrador
Snout Labrador BK
Mouth Grey Wolf
Nose Pug
Eyes Pug
Color French Bulldog