Kain Kate Crypto Game Dog - Mix of German Shepard, Labrador BK, Pug, Rottweiler, Husky, Yorkshire Terrier, St. Bernard and Poodle
Kain Kate
  • Purity 6%
  • Age 13 months
  • Racing Exp 20
  • German Shepard 18%
  • Gold medal 0 Silver medal 0 Bronze medal 3
  • 5 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

Good day to you! I'm Kain Kate! Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! I never met a leg I didn't want to hump. I want to find that special friend who enjoys sharing each other's doggie bags.

Racing Stats

Ran 5 races
  • 0 0 3
 Best Time16.62 sec
No rank  RacingĀ *** Pts
60.0 % wins (3) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACACATTATCATGATCAGCAGACGAAGAAGCA
C
A
C
A
C
A
T
T
A
T
C
A
T
G
A
T
C
A
G
C
A
G
A
C
G
A
A
G
A
A
G
C
A
Genes: H4F7B76I226

Composition

German Shepard
18%
Labrador BK
18%
Pug
18%
Rottweiler
9%
Husky
9%
Yorkshire Terrier
9%
St. Bernard
9%
Poodle
9%

Current Energy

Vitality -33 points
Lunar Effect -16 points

Traits Breakdown

Body Rottweiler
Tail Husky
Legs Yorkshire Terrier
Front Legs German Shepard
Head St. Bernard
Ears German Shepard
Snout Labrador BK
Mouth Poodle
Nose Pug
Eyes Pug
Color Labrador BK