Bosley Bungee Crypto Dog - Mix of Labrador, German Shepard, Rottweiler, Pitbull terrier, Labrador BK, Poodle, Pug, Husky and St. Bernard

Achievements

Racer
Podium Champion
Master Champion
Bosley Bungee
Hey, good-looking! This is Bosley Bungee. I've been known to take mega bytes when playing ruff. I love waking up early then indulging in long afternoon naps. Long or short hair works for me, just no baldies please. Fun-loving and playful only need apply.
  • Purity 3%
  • Age 18 months
  • Racing Exp 116
  • Labrador 18%
  • 33 races
  • Gen 6
Share it to make him Happy!
Neutral & Agile
Energy: ▂▃▅▆▇

Racing Stats

33 races   |
  • 2 4 9
 Best Time15.62 sec
No rank  Racing *** Pts
45.5 % wins (15) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACTCCCCATCACCATCAGCAGACGAAACATGA
C
A
C
T
C
C
C
C
A
T
C
A
C
C
A
T
C
A
G
C
A
G
A
C
G
A
A
A
C
A
T
G
A
Genes: HN57576I24B

Composition

Labrador
18%
German Shepard
18%
Rottweiler
9%
Pitbull terrier
9%
Labrador BK
9%
Poodle
9%
Pug
9%
Husky
9%
St. Bernard
9%

Current Energy

Vitality -21 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail Pitbull terrier
Legs Labrador
Front Legs German Shepard
Head Labrador
Ears German Shepard
Snout Labrador BK
Mouth Poodle
Nose Pug
Eyes Husky
Color St. Bernard