Bosley Bungee Crypto Dog - Mix of Labrador, German Shepard, Rottweiler, Pitbull terrier, Labrador BK, Poodle, Pug, Husky and St. Bernard
Bosley Bungee
  • Purity 3%
  • Age 51 months
  • Racing Exp 72
  • Labrador 18%
  • Gold medal 1 Silver medal 3 Bronze medal 6
  • 17 races
  • Gen 6
Depressed & Snaillike

Achievements

Podium Champion
Pro Racer
Master Champion

Bio

Hey, good-looking! This is Bosley Bungee. I've been known to take mega bytes when playing ruff. I love waking up early then indulging in long afternoon naps. Long or short hair works for me, just no baldies please. Fun-loving and playful only need apply.

Racing Stats

Ran 17 races
  • 1 3 6
 Best Time15.62 sec
No rank  RacingĀ *** Pts
58.8% wins (10) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACTCCCCATCACCATCAGCAGACGAAACATGA
C
A
C
T
C
C
C
C
A
T
C
A
C
C
A
T
C
A
G
C
A
G
A
C
G
A
A
A
C
A
T
G
A
Genes: HN57576I24B

Composition

Labrador
18%
German Shepard
18%
Rottweiler
9%
Pitbull terrier
9%
Labrador BK
9%
Poodle
9%
Pug
9%
Husky
9%
St. Bernard
9%

Current Energy

Vitality -21 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail Pitbull terrier
Legs Labrador
Front Legs German Shepard
Head Labrador
Ears German Shepard
Snout Labrador BK
Mouth Poodle
Nose Pug
Eyes Husky
Color St. Bernard

Parents

No Children

Photos

Litecoin canine race results Bitcoin dog race crypto doggy race photo online dog race crypto doggy race photo cryptocurrency dog racing results Bitcoin dog racing cryptocurrency doggy race photo
Gift