Bosley Bungee Crypto Dog - Mix of Labrador, German Shepard, Rottweiler, Pitbull terrier, Labrador BK, Poodle, Pug, Husky and St. Bernard
Bosley Bungee
  • Purity 3%
  • Age 13 months
  • Racing Exp 22
  • Labrador 18%
  • Gold medal 0 Silver medal 2 Bronze medal 1
  • 5 races
  • Gen 6
Depressed & Snaillike

Achievements

Racer

Bio

Hey, good-looking! This is Bosley Bungee. I've been known to take mega bytes when playing ruff. I love waking up early then indulging in long afternoon naps. Long or short hair works for me, just no baldies please. Fun-loving and playful only need apply.

Racing Stats

Ran 5 races
  • 0 2 1
 Best Time15.62 sec
Rank 71  RacingĀ *** Pts
60.0 % wins (3) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CACTCCCCATCACCATCAGCAGACGAAACATGA
C
A
C
T
C
C
C
C
A
T
C
A
C
C
A
T
C
A
G
C
A
G
A
C
G
A
A
A
C
A
T
G
A
Genes: HN57576I24B

Composition

Labrador
18%
German Shepard
18%
Rottweiler
9%
Pitbull terrier
9%
Labrador BK
9%
Poodle
9%
Pug
9%
Husky
9%
St. Bernard
9%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Pitbull terrier
Legs Labrador
Front Legs German Shepard
Head Labrador
Ears German Shepard
Snout Labrador BK
Mouth Poodle
Nose Pug
Eyes Husky
Color St. Bernard

Parents

No Children

Photos

Bitcoin dog race results cryptocurrency canine racing virtual dog race
Gift